EMAIL THIS PAGE TO A FRIEND

CASP14

caspase 14, apoptosis-related cysteine peptidase

63 Gene Product Result for
UniProtKB ID: P31944, O95823, Q3SYC9
Gene ID:
Human(23581) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This caspase has been shown to be processed and activated by caspase 8 and caspase 10 in vitro, and by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may be involved in keratinocyte terminal differentiation, which is important for the formation of the skin barrier. [provided by RefSeq, Jul 2008]
Mouse(12365) caspase 14
Rat(299587) caspase 14
naked mole-rat(101720095) caspase 14, apoptosis-related cysteine peptidase
domestic guinea pig(100715745) caspase 14, apoptosis-related cysteine peptidase
sheep(101120827) caspase 14, apoptosis-related cysteine peptidase
chicken(776274) caspase 14, apoptosis-related cysteine peptidase
cow(517658) caspase 14, apoptosis-related cysteine peptidase
domestic cat(101099027) caspase 14, apoptosis-related cysteine peptidase
dog(610460) caspase 14, apoptosis-related cysteine peptidase
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012114 Rosetta Predictions human pricing
XM_001077755 Rosetta Predictions rat pricing
XM_234878 Rosetta Predictions rat pricing
NM_009809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202857 predicted 508
2 SASI_Hs01_00202858 predicted 457
3 SASI_Hs01_00202859 predicted 526
4 SASI_Hs01_00202860 predicted 403
5 SASI_Hs01_00202861 predicted 258
6 SASI_Hs01_00202862 predicted 223
7 SASI_Hs01_00202863 predicted 262
8 SASI_Hs01_00202864 predicted 545
9 SASI_Hs01_00202865 predicted 281
10 SASI_Hs01_00202866 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358391 predicted 317
2 SASI_Rn02_00358392 predicted 210
3 SASI_Rn02_00358393 predicted 437
4 SASI_Rn02_00358394 predicted 305
5 SASI_Rn02_00358395 predicted 296
6 SASI_Rn02_00358396 predicted 502
7 SASI_Rn02_00358397 predicted 493
8 SASI_Rn02_00358398 predicted 488
9 SASI_Rn02_00358399 predicted 249
10 SASI_Rn02_00358400 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388718 predicted 312
2 SASI_Rn02_00388719 predicted 211
3 SASI_Rn02_00388720 predicted 445
4 SASI_Rn02_00388721 predicted 304
5 SASI_Rn02_00388722 predicted 296
6 SASI_Rn02_00388723 predicted 510
7 SASI_Rn02_00388724 predicted 497
8 SASI_Rn02_00388725 predicted 490
9 SASI_Rn02_00388726 predicted 250
10 SASI_Rn02_00388727 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022084 predicted 908
2 SASI_Mm01_00022085 predicted 816
3 SASI_Mm01_00022087 predicted 909
4 SASI_Mm02_00317091 predicted 989
5 SASI_Mm01_00022088 predicted 193
6 SASI_Mm01_00022089 predicted 750
7 SASI_Mm01_00022090 predicted 809
8 SASI_Mm01_00022091 predicted 413
9 SASI_Mm01_00022092 predicted 824
10 SASI_Mm01_00022093 predicted 734
11 SASI_Mm01_00022086 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009809
CASP14 MISSION shRNA Bacterial Glycerol Stock
caspase 14, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009809.2-1859s1c1
Sequence:CCGGCCCACTTCCTTGGTATCCATTCTCGAGAATGGATACCAAGGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-201s1c1
Sequence:CCGGGCAGGAGGAAAGATATGATATCTCGAGATATCATATCTTTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-354s1c1
Sequence:CCGGCCAGCAATTTCTGGAAGAGTTCTCGAGAACTCTTCCAGAAATTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-388s1c1
Sequence:CCGGCAGACCATAGATAATTGGGAACTCGAGTTCCCAATTATCTATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-784s1c1
Sequence:CCGGCTGACGGATGTGTTCATTCATCTCGAGATGAATGAACACATCCGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009809.4-1225s21c1
Sequence:CCGGTAGTAGCTTTCTGAACCATTTCTCGAGAAATGGTTCAGAAAGCTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-911s21c1
Sequence:CCGGCCTCCGGAAGAAGCTCTATTTCTCGAGAAATAGAGCTTCTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-739s21c1
Sequence:CCGGCCTATAGACATGACGAGAAAGCTCGAGCTTTCTCGTCATGTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009809
CASP14 MISSION shRNA shRNA Plasmid DNA
caspase 14, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009809.2-1859s1c1
Sequence:CCGGCCCACTTCCTTGGTATCCATTCTCGAGAATGGATACCAAGGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-201s1c1
Sequence:CCGGGCAGGAGGAAAGATATGATATCTCGAGATATCATATCTTTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-354s1c1
Sequence:CCGGCCAGCAATTTCTGGAAGAGTTCTCGAGAACTCTTCCAGAAATTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-388s1c1
Sequence:CCGGCAGACCATAGATAATTGGGAACTCGAGTTCCCAATTATCTATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-784s1c1
Sequence:CCGGCTGACGGATGTGTTCATTCATCTCGAGATGAATGAACACATCCGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009809.4-1225s21c1
Sequence:CCGGTAGTAGCTTTCTGAACCATTTCTCGAGAAATGGTTCAGAAAGCTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-911s21c1
Sequence:CCGGCCTCCGGAAGAAGCTCTATTTCTCGAGAAATAGAGCTTCTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-739s21c1
Sequence:CCGGCCTATAGACATGACGAGAAAGCTCGAGCTTTCTCGTCATGTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009809
CASP14 MISSION shRNA Lentiviral Transduction Particles
caspase 14, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009809.2-1859s1c1
Sequence:CCGGCCCACTTCCTTGGTATCCATTCTCGAGAATGGATACCAAGGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-201s1c1
Sequence:CCGGGCAGGAGGAAAGATATGATATCTCGAGATATCATATCTTTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-354s1c1
Sequence:CCGGCCAGCAATTTCTGGAAGAGTTCTCGAGAACTCTTCCAGAAATTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-388s1c1
Sequence:CCGGCAGACCATAGATAATTGGGAACTCGAGTTCCCAATTATCTATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009809.2-784s1c1
Sequence:CCGGCTGACGGATGTGTTCATTCATCTCGAGATGAATGAACACATCCGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009809.4-1225s21c1
Sequence:CCGGTAGTAGCTTTCTGAACCATTTCTCGAGAAATGGTTCAGAAAGCTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-911s21c1
Sequence:CCGGCCTCCGGAAGAAGCTCTATTTCTCGAGAAATAGAGCTTCTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009809.4-739s21c1
Sequence:CCGGCCTATAGACATGACGAGAAAGCTCGAGCTTTCTCGTCATGTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012114
CASP14 MISSION shRNA Bacterial Glycerol Stock
caspase 14, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-499s1c1
Sequence:CCGGGTCATCAAAGACAGCCCACAACTCGAGTTGTGGGCTGTCTTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-408s1c1
Sequence:CCGGGCGAGCTAAGCCCAAGGTGTACTCGAGTACACCTTGGGCTTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-536s1c1
Sequence:CCGGCAGATGCCTTGCACGTTTATTCTCGAGAATAAACGTGCAAGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-183s1c1
Sequence:CCGGGCTGAGATTCGAAAGCACCATCTCGAGATGGTGCTTTCGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-74s21c1
Sequence:CCGGAGGAGAAATATGATATGTCAGCTCGAGCTGACATATCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-569s21c1
Sequence:CCGGGATACATCGCCTACCGACATGCTCGAGCATGTCGGTAGGCGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-158s21c1
Sequence:CCGGATGCTCTGGAACACATGTTTCCTCGAGGAAACATGTGTTCCAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012114
CASP14 MISSION shRNA shRNA Plasmid DNA
caspase 14, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-499s1c1
Sequence:CCGGGTCATCAAAGACAGCCCACAACTCGAGTTGTGGGCTGTCTTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-408s1c1
Sequence:CCGGGCGAGCTAAGCCCAAGGTGTACTCGAGTACACCTTGGGCTTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-536s1c1
Sequence:CCGGCAGATGCCTTGCACGTTTATTCTCGAGAATAAACGTGCAAGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-183s1c1
Sequence:CCGGGCTGAGATTCGAAAGCACCATCTCGAGATGGTGCTTTCGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-74s21c1
Sequence:CCGGAGGAGAAATATGATATGTCAGCTCGAGCTGACATATCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-569s21c1
Sequence:CCGGGATACATCGCCTACCGACATGCTCGAGCATGTCGGTAGGCGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-158s21c1
Sequence:CCGGATGCTCTGGAACACATGTTTCCTCGAGGAAACATGTGTTCCAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012114
CASP14 MISSION shRNA Lentiviral Transduction Particles
caspase 14, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-499s1c1
Sequence:CCGGGTCATCAAAGACAGCCCACAACTCGAGTTGTGGGCTGTCTTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-408s1c1
Sequence:CCGGGCGAGCTAAGCCCAAGGTGTACTCGAGTACACCTTGGGCTTAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-536s1c1
Sequence:CCGGCAGATGCCTTGCACGTTTATTCTCGAGAATAAACGTGCAAGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012114.1-183s1c1
Sequence:CCGGGCTGAGATTCGAAAGCACCATCTCGAGATGGTGCTTTCGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-74s21c1
Sequence:CCGGAGGAGAAATATGATATGTCAGCTCGAGCTGACATATCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-569s21c1
Sequence:CCGGGATACATCGCCTACCGACATGCTCGAGCATGTCGGTAGGCGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012114.1-158s21c1
Sequence:CCGGATGCTCTGGAACACATGTTTCCTCGAGGAAACATGTGTTCCAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks