EMAIL THIS PAGE TO A FRIEND

CASP1

caspase 1, apoptosis-related cysteine peptidase

118 Gene Product Result for
Synonyms: ICE IL1BC P45
Gene ID:
Human(834) Summary: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Mouse(12362) caspase 1
Rat(25166) caspase 1
chicken(395764) caspase 1, apoptosis-related cysteine peptidase
domestic cat(493961) caspase 1, apoptosis-related cysteine peptidase
cow(514214) caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)
Horse(100033888) caspase 1, apoptosis-related cysteine peptidase
naked mole-rat(101725179) caspase 1, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A0835 N-Acetyl-Asp-Glu-Val-Asp-al ≥95%, powder human pricing
N1413 NSCI ≥97% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001223 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097671 MISSION® esiRNA esiRNA human CASP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001223 Rosetta Predictions human pricing
NM_033292 Rosetta Predictions human pricing
NM_033293 Rosetta Predictions human pricing
NM_033294 Rosetta Predictions human pricing
NM_033295 Rosetta Predictions human pricing
NM_012762 Rosetta Predictions rat pricing
NM_009807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157781 predicted 703
2 SASI_Hs02_00331381 predicted 724
3 SASI_Hs01_00157782 predicted 514
4 SASI_Hs01_00157783 predicted 411
5 SASI_Hs01_00157784 predicted 1206
6 SASI_Hs01_00157785 predicted 847
7 SASI_Hs01_00157786 predicted 708
8 SASI_Hs01_00157788 predicted 1118
9 SASI_Hs01_00157789 predicted 396
10 SASI_Hs01_00157790 predicted 722
11 SASI_Hs01_00157787 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193993 predicted 771
2 SASI_Hs02_00361102 predicted 794
3 SASI_Hs01_00193994 predicted 574
4 SASI_Hs01_00193995 predicted 470
5 SASI_Hs01_00193996 predicted 1271
6 SASI_Hs01_00193997 predicted 913
7 SASI_Hs01_00193998 predicted 771
8 SASI_Hs01_00194000 predicted 1188
9 SASI_Hs01_00194001 predicted 1181
10 SASI_Hs01_00194002 predicted 458
11 SASI_Hs01_00193999 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087529 predicted 490
2 SASI_Hs01_00087530 predicted 510
3 SASI_Hs01_00087531 predicted 297
4 SASI_Hs01_00087532 predicted 197
5 SASI_Hs01_00087533 predicted 995
6 SASI_Hs01_00087534 predicted 628
7 SASI_Hs02_00361103 predicted 254
8 SASI_Hs01_00087535 predicted 495
9 SASI_Hs01_00087537 predicted 907
10 SASI_Hs01_00087538 predicted 897
11 SASI_Hs01_00087536 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361104 predicted 678
2 SASI_Hs01_00024989 predicted 492
3 SASI_Hs01_00024990 predicted 513
4 SASI_Hs01_00024991 predicted 294
5 SASI_Hs01_00024992 predicted 195
6 SASI_Hs01_00024993 predicted 850
7 SASI_Hs01_00024994 predicted 650
8 SASI_Hs01_00024995 predicted 253
9 SASI_Hs01_00024996 predicted 490
10 SASI_Hs01_00024998 predicted 765
11 SASI_Hs01_00024997 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170790 predicted 316
2 SASI_Hs01_00170791 predicted 318
3 SASI_Hs01_00170792 predicted 297
4 SASI_Hs02_00361105 predicted 120
5 SASI_Hs02_00361106 predicted 153
6 SASI_Hs02_00361107 predicted 51
7 SASI_Hs01_00170794 predicted 240
8 SASI_Hs01_00170795 predicted 256
9 SASI_Hs01_00170796 predicted 234
10 SASI_Hs01_00170797 predicted 225
11 SASI_Hs01_00170789 predicted 225
12 SASI_Hs01_00170793 predicted 302
13 SASI_Hs01_00170798 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096643 predicted 205
2 SASI_Rn01_00096644 predicted 942
3 SASI_Rn01_00096645 predicted 438
4 SASI_Rn01_00096646 predicted 679
5 SASI_Rn01_00096647 predicted 762
6 SASI_Rn01_00096648 predicted 669
7 SASI_Rn01_00096650 predicted 908
8 SASI_Rn01_00096651 predicted 728
9 SASI_Rn02_00260130 predicted 442
10 SASI_Rn02_00260131 predicted 1038
11 SASI_Rn01_00096649 predicted 356
12 SASI_Rn01_00096652 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089611 predicted 1135
2 SASI_Mm01_00089612 predicted 444
3 SASI_Mm01_00089614 predicted 872
4 SASI_Mm01_00089615 predicted 328
5 SASI_Mm01_00089616 predicted 656
6 SASI_Mm01_00089617 predicted 893
7 SASI_Mm02_00317089 predicted 971
8 SASI_Mm01_00089618 predicted 359
9 SASI_Mm01_00089619 predicted 223
10 SASI_Mm01_00089620 predicted 987
11 SASI_Mm01_00089613 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009807
VALIDATED
CASP1 MISSION shRNA Bacterial Glycerol Stock
caspase 1, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-486s21c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-906s21c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1021s21c1
Sequence:CCGGACAAGCCCAAGGTGATCATTACTCGAGTAATGATCACCTTGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-619s21c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1110s21c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-410s1c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-38s1c1
Sequence:CCGGCAGTGAGTATAGGGACAATAACTCGAGTTATTGTCCCTATACTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-901s1c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-697s1c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-277s1c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009807
VALIDATED
CASP1 MISSION shRNA shRNA Plasmid DNA
caspase 1, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-486s21c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-906s21c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1021s21c1
Sequence:CCGGACAAGCCCAAGGTGATCATTACTCGAGTAATGATCACCTTGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-619s21c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1110s21c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-410s1c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-38s1c1
Sequence:CCGGCAGTGAGTATAGGGACAATAACTCGAGTTATTGTCCCTATACTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-901s1c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-697s1c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-277s1c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009807
VALIDATED
CASP1 MISSION shRNA Lentiviral Transduction Particles
caspase 1, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-486s21c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-906s21c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1021s21c1
Sequence:CCGGACAAGCCCAAGGTGATCATTACTCGAGTAATGATCACCTTGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-619s21c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009807.2-1110s21c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-410s1c1
Sequence:CCGGCCCAGAAGTTATGGAAAGAAACTCGAGTTTCTTTCCATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-38s1c1
Sequence:CCGGCAGTGAGTATAGGGACAATAACTCGAGTTATTGTCCCTATACTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-901s1c1
Sequence:CCGGGATTTCTTAACGGATGCAATTCTCGAGAATTGCATCCGTTAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-697s1c1
Sequence:CCGGCATGGTATCCAGGAGGGAATACTCGAGTATTCCCTCCTGGATACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009807.1-277s1c1
Sequence:CCGGGAAACATTTGTTGCTACAGAACTCGAGTTCTGTAGCAACAAATGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001223
CASP1 MISSION shRNA Bacterial Glycerol Stock
caspase 1, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-711s1c1
Sequence:CCGGCCAGATATACTACAACTCAATCTCGAGATTGAGTTGTAGTATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-437s1c1
Sequence:CCGGCACACGTCTTGCTCTCATTATCTCGAGATAATGAGAGCAAGACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-720s1c1
Sequence:CCGGCTACAACTCAATGCAATCTTTCTCGAGAAAGATTGCATTGAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-885s1c1
Sequence:CCGGGAAGAGTTTGAGGATGATGCTCTCGAGAGCATCATCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001223.x-1181s1c1
Sequence:CCGGTGTATGAATGTCTGCTGGGCACTCGAGTGCCCAGCAGACATTCATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001223
CASP1 MISSION shRNA shRNA Plasmid DNA
caspase 1, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-711s1c1
Sequence:CCGGCCAGATATACTACAACTCAATCTCGAGATTGAGTTGTAGTATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-437s1c1
Sequence:CCGGCACACGTCTTGCTCTCATTATCTCGAGATAATGAGAGCAAGACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-720s1c1
Sequence:CCGGCTACAACTCAATGCAATCTTTCTCGAGAAAGATTGCATTGAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-885s1c1
Sequence:CCGGGAAGAGTTTGAGGATGATGCTCTCGAGAGCATCATCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001223.x-1181s1c1
Sequence:CCGGTGTATGAATGTCTGCTGGGCACTCGAGTGCCCAGCAGACATTCATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001223
CASP1 MISSION shRNA Lentiviral Transduction Particles
caspase 1, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-711s1c1
Sequence:CCGGCCAGATATACTACAACTCAATCTCGAGATTGAGTTGTAGTATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-437s1c1
Sequence:CCGGCACACGTCTTGCTCTCATTATCTCGAGATAATGAGAGCAAGACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-720s1c1
Sequence:CCGGCTACAACTCAATGCAATCTTTCTCGAGAAAGATTGCATTGAGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001223.x-885s1c1
Sequence:CCGGGAAGAGTTTGAGGATGATGCTCTCGAGAGCATCATCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001223.x-1181s1c1
Sequence:CCGGTGTATGAATGTCTGCTGGGCACTCGAGTGCCCAGCAGACATTCATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks