EMAIL THIS PAGE TO A FRIEND

CASP2

caspase 2, apoptosis-related cysteine peptidase

147 Gene Product Result for
Synonyms: CASP-2 ICH1 NEDD-2 NEDD2 PPP1R57
Gene ID:
Human(835) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Caspases mediate cellular apoptosis through the proteolytic cleavage of specific protein substrates. The encoded protein may function in stress-induced cell death pathways, cell cycle maintenance, and the suppression of tumorigenesis. Increased expression of this gene may play a role in neurodegenerative disorders including Alzheimer's disease, Huntington's disease and temporal lobe epilepsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(12366) caspase 2
Rat(64314) caspase 2
Zebrafish(373118) caspase 2, apoptosis-related cysteine protease
chicken(395857) caspase 2, apoptosis-related cysteine peptidase
dog(482737) caspase 2, apoptosis-related cysteine peptidase
domestic cat(101088318) caspase 2, apoptosis-related cysteine peptidase
cow(531419) caspase 2, apoptosis-related cysteine peptidase
naked mole-rat(101712106) caspase 2, apoptosis-related cysteine peptidase
domestic guinea pig(100735399) caspase 2, apoptosis-related cysteine peptidase
sheep(101115025) caspase 2, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1605 Z-Val-Asp(O-Me)-Val-Ala-Asp(O-Me) fluoromethyl ketone powder, ≥95% (TLC) human, mouse, rat pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A5345 N-Acetyl-Val-Asp-Val-Ala-Asp-7-amido-4-trifluoromethylcoumarin ≥97% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032982 Rosetta Predictions human pricing
NM_032983 Rosetta Predictions human pricing
NM_022522 Rosetta Predictions rat pricing
NM_007610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066908 predicted 1960
2 SASI_Hs01_00066909 predicted 1180
3 SASI_Hs01_00066910 predicted 1764
4 SASI_Hs01_00066911 predicted 1721
5 SASI_Hs01_00066912 predicted 1852
6 SASI_Hs01_00066914 predicted 989
7 SASI_Hs01_00066915 predicted 1651
8 SASI_Hs01_00066916 predicted 1550
9 SASI_Hs01_00066917 predicted 1751
10 SASI_Hs02_00360616 predicted 1564
11 SASI_Hs01_00066913 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241638 predicted 771
2 SASI_Hs02_00360617 predicted 247
3 SASI_Hs01_00241640 predicted 529
4 SASI_Hs01_00241641 predicted 633
5 SASI_Hs01_00241643 predicted 289
6 SASI_Hs01_00241644 predicted 191
7 SASI_Hs01_00241645 predicted 247
8 SASI_Hs02_00360618 predicted 665
9 SASI_Hs01_00241646 predicted 366
10 SASI_Hs01_00241647 predicted 637
11 SASI_Hs01_00241639 predicted 484
12 SASI_Hs01_00241642 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106914 predicted 1460
2 SASI_Rn01_00106915 predicted 561
3 SASI_Rn02_00263272 predicted 1294
4 SASI_Rn01_00106917 predicted 382
5 SASI_Rn01_00106918 predicted 569
6 SASI_Rn01_00106919 predicted 1286
7 SASI_Rn01_00106920 predicted 362
8 SASI_Rn01_00106921 predicted 480
9 SASI_Rn01_00106922 predicted 1091
10 SASI_Rn01_00106923 predicted 1234
11 SASI_Rn01_00106916 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035068 predicted 787
2 SASI_Mm01_00035069 predicted 1180
3 SASI_Mm01_00035070 predicted 652
4 SASI_Mm01_00035071 predicted 1365
5 SASI_Mm01_00035072 predicted 526
6 SASI_Mm01_00035073 predicted 1054
7 SASI_Mm01_00035074 predicted 1194
8 SASI_Mm01_00035075 predicted 441
9 SASI_Mm01_00035076 predicted 1485
10 SASI_Mm02_00312062 predicted 1123
11 SASI_Mm01_00035077 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032982
VALIDATED
CASP2 MISSION shRNA Bacterial Glycerol Stock
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-540s21c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1715s21c1
Sequence:CCGGCCAGCCTTGGTTGGACCTATTCTCGAGAATAGGTCCAACCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-634s21c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-493s21c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1223s21c1
Sequence:CCGGCCACGCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032982
VALIDATED
CASP2 MISSION shRNA shRNA Plasmid DNA
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-540s21c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1715s21c1
Sequence:CCGGCCAGCCTTGGTTGGACCTATTCTCGAGAATAGGTCCAACCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-634s21c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-493s21c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1223s21c1
Sequence:CCGGCCACGCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032982
VALIDATED
CASP2 MISSION shRNA Lentiviral Transduction Particles
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-540s21c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1715s21c1
Sequence:CCGGCCAGCCTTGGTTGGACCTATTCTCGAGAATAGGTCCAACCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-634s21c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-493s21c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032982.2-1223s21c1
Sequence:CCGGCCACGCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007610
VALIDATED
CASP2 MISSION shRNA Bacterial Glycerol Stock
caspase 2, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-563s21c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1291s21c1
Sequence:CCGGCGTGGCCGACATGCTTGTTAACTCGAGTTAACAAGCATGTCGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1161s21c1
Sequence:CCGGCTACTCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-441s21c1
Sequence:CCGGTCACAACCCTCTCAGATATTCCTCGAGGAATATCTGAGAGGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007610.1-1621s21c1
Sequence:CCGGTGTCGTGTTCTCTACCTATAGCTCGAGCTATAGGTAGAGAACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007610.1-1903s1c1
Sequence:CCGGCCCAATTTAATGTAGGTGTTTCTCGAGAAACACCTACATTAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-563s1c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007610.1-1195s1c1
Sequence:CCGGCCTTAAAGGTAATGCTGCCATCTCGAGATGGCAGCATTACCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-1319s1c1
Sequence:CCGGGCCCTTATCAAGGAGCGTGAACTCGAGTTCACGCTCCTTGATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007610
VALIDATED
CASP2 MISSION shRNA shRNA Plasmid DNA
caspase 2, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-563s21c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1291s21c1
Sequence:CCGGCGTGGCCGACATGCTTGTTAACTCGAGTTAACAAGCATGTCGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1161s21c1
Sequence:CCGGCTACTCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-441s21c1
Sequence:CCGGTCACAACCCTCTCAGATATTCCTCGAGGAATATCTGAGAGGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007610.1-1621s21c1
Sequence:CCGGTGTCGTGTTCTCTACCTATAGCTCGAGCTATAGGTAGAGAACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007610.1-1903s1c1
Sequence:CCGGCCCAATTTAATGTAGGTGTTTCTCGAGAAACACCTACATTAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-563s1c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007610.1-1195s1c1
Sequence:CCGGCCTTAAAGGTAATGCTGCCATCTCGAGATGGCAGCATTACCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-1319s1c1
Sequence:CCGGGCCCTTATCAAGGAGCGTGAACTCGAGTTCACGCTCCTTGATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007610
VALIDATED
CASP2 MISSION shRNA Lentiviral Transduction Particles
caspase 2, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-563s21c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1291s21c1
Sequence:CCGGCGTGGCCGACATGCTTGTTAACTCGAGTTAACAAGCATGTCGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-1161s21c1
Sequence:CCGGCTACTCGCTCAGACATGATATCTCGAGATATCATGTCTGAGCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007610.1-441s21c1
Sequence:CCGGTCACAACCCTCTCAGATATTCCTCGAGGAATATCTGAGAGGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007610.1-1621s21c1
Sequence:CCGGTGTCGTGTTCTCTACCTATAGCTCGAGCTATAGGTAGAGAACACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007610.1-1903s1c1
Sequence:CCGGCCCAATTTAATGTAGGTGTTTCTCGAGAAACACCTACATTAAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-563s1c1
Sequence:CCGGGCTACGGAACACTCCTTAGATCTCGAGATCTAAGGAGTGTTCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007610.1-1195s1c1
Sequence:CCGGCCTTAAAGGTAATGCTGCCATCTCGAGATGGCAGCATTACCTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007610.1-1319s1c1
Sequence:CCGGGCCCTTATCAAGGAGCGTGAACTCGAGTTCACGCTCCTTGATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001224
VALIDATED
CASP2 MISSION shRNA Bacterial Glycerol Stock
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001224.x-2332s1c1
Sequence:CCGGCCTGCTTCATATCTCTCCCTTCTCGAGAAGGGAGAGATATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-482s1c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-388s1c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-341s1c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-680s1c1
Sequence:CCGGCTAGTCACCCTCTTCAAGCTTCTCGAGAAGCTTGAAGAGGGTGACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001224
VALIDATED
CASP2 MISSION shRNA shRNA Plasmid DNA
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001224.x-2332s1c1
Sequence:CCGGCCTGCTTCATATCTCTCCCTTCTCGAGAAGGGAGAGATATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-482s1c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-388s1c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-341s1c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-680s1c1
Sequence:CCGGCTAGTCACCCTCTTCAAGCTTCTCGAGAAGCTTGAAGAGGGTGACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001224
VALIDATED
CASP2 MISSION shRNA Lentiviral Transduction Particles
caspase 2, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001224.x-2332s1c1
Sequence:CCGGCCTGCTTCATATCTCTCCCTTCTCGAGAAGGGAGAGATATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-482s1c1
Sequence:CCGGCACTCCCTAGACAATAAAGATCTCGAGATCTTTATTGTCTAGGGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-388s1c1
Sequence:CCGGGTTGAGCTGTGACTACGACTTCTCGAGAAGTCGTAGTCACAGCTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-341s1c1
Sequence:CCGGGATATGTTGCTCACCACCCTTCTCGAGAAGGGTGGTGAGCAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001224.x-680s1c1
Sequence:CCGGCTAGTCACCCTCTTCAAGCTTCTCGAGAAGCTTGAAGAGGGTGACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks