EMAIL THIS PAGE TO A FRIEND

CASP3

caspase 3, apoptosis-related cysteine peptidase

159 Gene Product Result for
Synonyms: CPP32 CPP32B SCA-1
UniProtKB ID: P42574, A8K5M2, D3DP53, Q96AN1, Q96KP2
Gene ID:
Human(836) Summary: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 6, 7 and 9, and the protein itself is processed by caspases 8, 9 and 10. It is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which is associated with neuronal death in Alzheimer's disease. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(12367) caspase 3
Rat(25402) caspase 3
sheep(443031) caspase 3, apoptosis-related cysteine peptidase
Domestic Rabbit(100008840) caspase 3, apoptosis-related cysteine peptidase
domestic guinea pig(100718309) caspase 3, apoptosis-related cysteine peptidase
naked mole-rat(101712867) caspase 3, apoptosis-related cysteine peptidase
chicken(395476) caspase 3, apoptosis-related cysteine peptidase
domestic cat(493932) caspase 3, apoptosis-related cysteine peptidase
cow(408016) caspase 3, apoptosis-related cysteine peptidase
Horse(100034083) caspase 3, apoptosis-related cysteine peptidase
dog(403567) caspase 3, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503294 Anti-CASP3 (p17, Cleaved-Asp175) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB2501669 Anti-CASP3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, canine, human
ELISA, western blot pricing
HPA002643 Anti-CASP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV00021 Anti-CASP3 antibody produced in rabbit IgG fraction of antiserum rat, rabbit, bovine, canine, horse, human, guinea pig, pig
western blot pricing
SAB4503291 Anti-CASP3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
C9598 Anti-Caspase 3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
C8487 Anti-Caspase 3, Active antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, mouse, rat, canine, human, pig
immunofluorescence, microarray, western blot pricing
SAB1305630 ANTI-CLEAVED-CASP3 (ASP175) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB4503292 Anti-CSPN3 (Cleaved-Asp175) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504126 Anti-phospho-Caspase 3 (pSer150) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
WH0000836M2 Monoclonal Anti-CASP3 antibody produced in mouse clone 4D3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
C5737 Monoclonal Anti-Caspase 3 antibody produced in mouse clone 84803.111, purified immunoglobulin, lyophilized powder human
western blot pricing

Activity Assay

Product # Description Species Add to Cart
 
CASP3C Caspase 3 Assay Kit, Colorimetric human pricing
CASP3F Caspase 3 Assay Kit, Fluorimetric human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085021 MISSION® esiRNA esiRNA human CASP3 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
06-735 Anti-Caspase 3 Antibody 200 µg, This Anti-Caspase 3 Antibody is validated for use in WB for the detection of Caspase 3. pricing
AB3640 Anti-Caspase 3 Antibody 100 µg, Detect Caspase 3 using this Anti-Caspase 3 Antibody validated for use in WB. pricing
ABC495 Anti-Caspase 3 Antibody 50 μg, Anti-Caspase 3 Antibody is an antibody against Caspase 3 Antibody for use in Western Blotting and Immunocytochemistry. pricing
AB3623 Anti-Caspase 3 Antibody, active (cleaved) form 50 µg, Anti-Caspase 3 Antibody, active (cleaved) form detects level of Caspase 3 and has been published and validated for use in Immunofluorescence (IF), Immunohistochemistry (IHC), and Western Blot (WB). pricing
05-654 Anti-Caspase 3 Antibody, clone 4-1-18 100 µg, Anti-Caspase 3 Antibody, clone 4-1-18 is an antibody against Caspase 3 for use in WB. pricing
AB1899 Anti-Caspase 3 Antibody, large subunit & proform 50 µg, This Anti-Caspase 3 Antibody, large subunit & proform is validated for use in WB for the detection of Caspase 3. pricing
MAB4603 Anti-Caspase 3 Antibody, large subunit & proform, clone 3CSP03 50 µg, Detect Caspase 3 using this Anti-Caspase 3 Antibody, large subunit & proform, clone 3CSP03 validated for use in IP, WB, IH(P). pricing
MAB4703 Anti-Caspase 3 Antibody, large subunit & proform, clone 4-1-18 100 µg, Anti-Caspase 3 Antibody, large subunit & proform, clone 4-1-18 detects level of Caspase 3 & has been published & validated for use in WB, IH(P). pricing
MAB10753 Anti-Caspase3 (active form) Antibody, clone 3D9.3 100 µg, Anti-Caspase3 (active form), clone 3D9.3 is an antibody targeting the Caspase3 (active form) protein, validated for use in WB, ICC & Flow. pricing
APT131 Caspase 3 Colorimetric Activity Assay Kit, DEVD 25 assays, Caspase-3 Colorimetric Activity Assay Kits provide a simple & convenient means for assaying the activity of caspases that recognize the sequence DEVD. pricing
12-323 Caspase 3 Fluorometric Substrate 5 mg, Caspase 3 Fluorometric Substrate (Ac-Asp-Glu-Val-Asp-AMC) for use in Capase activity assays. Can be used to assay Apopain activity in vitro. pricing
CC119 Human Caspase 3, recombinant human active 25 units pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004346 Rosetta Predictions human pricing
NM_032991 Rosetta Predictions human pricing
NM_012922 Rosetta Predictions rat pricing
NM_009810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139105 predicted 1347
2 SASI_Hs01_00139106 predicted 778
3 SASI_Hs01_00139107 predicted 862
4 SASI_Hs01_00139108 predicted 448
5 SASI_Hs01_00139109 predicted 847
6 SASI_Hs01_00139110 predicted 820
7 SASI_Hs01_00139111 predicted 697
8 SASI_Hs01_00139112 predicted 549
9 SASI_Hs01_00139113 predicted 504
10 SASI_Hs02_00337409 predicted 613
11 SASI_Hs01_00139104 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219179 predicted 1185
2 SASI_Hs01_00219180 predicted 616
3 SASI_Hs01_00219181 predicted 696
4 SASI_Hs01_00219182 predicted 282
5 SASI_Hs01_00219183 predicted 682
6 SASI_Hs01_00219184 predicted 658
7 SASI_Hs01_00219185 predicted 527
8 SASI_Hs01_00219186 predicted 380
9 SASI_Hs01_00219187 predicted 334
10 SASI_Hs02_00360625 predicted 441
11 SASI_Hs01_00219178 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100273 predicted 323
2 SASI_Rn01_00100275 predicted 505
3 SASI_Rn01_00100276 predicted 1212
4 SASI_Rn01_00100277 predicted 1331
5 SASI_Rn01_00100278 predicted 1214
6 SASI_Rn01_00100279 predicted 1299
7 SASI_Rn01_00100280 predicted 397
8 SASI_Rn01_00100281 predicted 1322
9 SASI_Rn02_00260464 predicted 1328
10 SASI_Rn02_00260465 predicted 1289
11 SASI_Rn01_00100272 predicted 1327
12 SASI_Rn01_00100274 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040022 predicted 400
2 SASI_Mm01_00040023 predicted 474
3 SASI_Mm01_00040024 predicted 1165
4 SASI_Mm01_00040025 predicted 574
5 SASI_Mm01_00040026 predicted 403
6 SASI_Mm02_00317092 predicted 637
7 SASI_Mm02_00317093 predicted 514
8 SASI_Mm01_00040029 predicted 344
9 SASI_Mm02_00317094 predicted 286
10 SASI_Mm01_00040030 predicted 665
11 SASI_Mm01_00040021 predicted 1170
12 SASI_Mm01_00040027 predicted 360
13 SASI_Mm01_00040028 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004346
VALIDATED
CASP3 MISSION shRNA Bacterial Glycerol Stock
caspase 3, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-306s1c1
Sequence:CCGGGCGAATCAATGGACTCTGGAACTCGAGTTCCAGAGTCCATTGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004346.x-359s1c1
Sequence:CCGGCCTGAGATGGGTTTATGTATACTCGAGTATACATAAACCCATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-955s1c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004346.3-2211s21c1
Sequence:CCGGCTAAAGGTGGTGAGGCAATAACTCGAGTTATTGCCTCACCACCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-983s21c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-356s21c1
Sequence:CCGGATCCCTGGACAACAGTTATAACTCGAGTTATAACTGTTGTCCAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-855s21c1
Sequence:CCGGTCCACAGCACCTGGTTATTATCTCGAGATAATAACCAGGTGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-940s21c1
Sequence:CCGGATGCCGACAAGCTTGAATTTACTCGAGTAAATTCAAGCTTGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004346
VALIDATED
CASP3 MISSION shRNA shRNA Plasmid DNA
caspase 3, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-306s1c1
Sequence:CCGGGCGAATCAATGGACTCTGGAACTCGAGTTCCAGAGTCCATTGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004346.x-359s1c1
Sequence:CCGGCCTGAGATGGGTTTATGTATACTCGAGTATACATAAACCCATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-955s1c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004346.3-2211s21c1
Sequence:CCGGCTAAAGGTGGTGAGGCAATAACTCGAGTTATTGCCTCACCACCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-983s21c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-356s21c1
Sequence:CCGGATCCCTGGACAACAGTTATAACTCGAGTTATAACTGTTGTCCAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-855s21c1
Sequence:CCGGTCCACAGCACCTGGTTATTATCTCGAGATAATAACCAGGTGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-940s21c1
Sequence:CCGGATGCCGACAAGCTTGAATTTACTCGAGTAAATTCAAGCTTGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004346
VALIDATED
CASP3 MISSION shRNA Lentiviral Transduction Particles
caspase 3, apoptosis-related cysteine peptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-306s1c1
Sequence:CCGGGCGAATCAATGGACTCTGGAACTCGAGTTCCAGAGTCCATTGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004346.x-359s1c1
Sequence:CCGGCCTGAGATGGGTTTATGTATACTCGAGTATACATAAACCCATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004346.x-955s1c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004346.3-2211s21c1
Sequence:CCGGCTAAAGGTGGTGAGGCAATAACTCGAGTTATTGCCTCACCACCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-983s21c1
Sequence:CCGGCCGAAAGGTGGCAACAGAATTCTCGAGAATTCTGTTGCCACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-356s21c1
Sequence:CCGGATCCCTGGACAACAGTTATAACTCGAGTTATAACTGTTGTCCAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-855s21c1
Sequence:CCGGTCCACAGCACCTGGTTATTATCTCGAGATAATAACCAGGTGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004346.3-940s21c1
Sequence:CCGGATGCCGACAAGCTTGAATTTACTCGAGTAAATTCAAGCTTGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009810
VALIDATED
CASP3 MISSION shRNA Bacterial Glycerol Stock
caspase 3, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009810.1-1138s1c1
Sequence:CCGGGAAATTACAAAGTTGCCCTTTCTCGAGAAAGGGCAACTTTGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-762s1c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-149s1c1
Sequence:CCGGCTGGGATCTATCTGGACAGTACTCGAGTACTGTCCAGATAGATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-741s1c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-868s1c1
Sequence:CCGGCTCACGAAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTTCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-741s21c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-762s21c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-1060s21c1
Sequence:CCGGTCGACATCAGGTAGTTGAAATCTCGAGATTTCAACTACCTGATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-140s21c1
Sequence:CCGGCAGTGGACTCTGGGATCTATCCTCGAGGATAGATCCCAGAGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-656s21c1
Sequence:CCGGCTACAGCACCTGGTTACTATTCTCGAGAATAGTAACCAGGTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009810
VALIDATED
CASP3 MISSION shRNA shRNA Plasmid DNA
caspase 3, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009810.1-1138s1c1
Sequence:CCGGGAAATTACAAAGTTGCCCTTTCTCGAGAAAGGGCAACTTTGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-762s1c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-149s1c1
Sequence:CCGGCTGGGATCTATCTGGACAGTACTCGAGTACTGTCCAGATAGATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-741s1c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-868s1c1
Sequence:CCGGCTCACGAAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTTCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-741s21c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-762s21c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-1060s21c1
Sequence:CCGGTCGACATCAGGTAGTTGAAATCTCGAGATTTCAACTACCTGATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-140s21c1
Sequence:CCGGCAGTGGACTCTGGGATCTATCCTCGAGGATAGATCCCAGAGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-656s21c1
Sequence:CCGGCTACAGCACCTGGTTACTATTCTCGAGAATAGTAACCAGGTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009810
VALIDATED
CASP3 MISSION shRNA Lentiviral Transduction Particles
caspase 3, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009810.1-1138s1c1
Sequence:CCGGGAAATTACAAAGTTGCCCTTTCTCGAGAAAGGGCAACTTTGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-762s1c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-149s1c1
Sequence:CCGGCTGGGATCTATCTGGACAGTACTCGAGTACTGTCCAGATAGATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009810.1-741s1c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009810.1-868s1c1
Sequence:CCGGCTCACGAAAGAACTGTACTTTCTCGAGAAAGTACAGTTCTTTCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-741s21c1
Sequence:CCGGCGCGCACAAGCTAGAATTTATCTCGAGATAAATTCTAGCTTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-762s21c1
Sequence:CCGGGCACATTCTCACTCGCGTTAACTCGAGTTAACGCGAGTGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-1060s21c1
Sequence:CCGGTCGACATCAGGTAGTTGAAATCTCGAGATTTCAACTACCTGATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-140s21c1
Sequence:CCGGCAGTGGACTCTGGGATCTATCCTCGAGGATAGATCCCAGAGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009810.2-656s21c1
Sequence:CCGGCTACAGCACCTGGTTACTATTCTCGAGAATAGTAACCAGGTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks