EMAIL THIS PAGE TO A FRIEND

CASP4

caspase 4, apoptosis-related cysteine peptidase

85 Gene Product Result for
Synonyms: ICE(rel)II ICEREL-II ICH-2 Mih1/TX TX
UniProtKB ID: P49662, A2NHL8, A2NHM0
Gene ID:
Human(837) Summary: This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(12363) caspase 4, apoptosis-related cysteine peptidase
Rat(114555) caspase 4, apoptosis-related cysteine peptidase
dog(403724) caspase 4, apoptosis-related cysteine peptidase
cow(338039) caspase 4, apoptosis-related cysteine peptidase
naked mole-rat(101700797) caspase 4, apoptosis-related cysteine peptidase
domestic guinea pig(100731032) caspase 4, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503296 Anti-CASP4 (p20, Cleaved-Gln81) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2500199 Anti-CASP4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA027588 Anti-CASP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
C4481 Anti-Caspase 4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, microarray, western blot pricing
PRS2245 Anti-Caspase-13 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB3500401 Anti-Caspase-4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
GW21153 Anti-Mih1/Tx antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
C1354 Monoclonal Anti-Caspase 11 antibody produced in rat clone 17D9, purified from hybridoma cell culture mouse
immunohistochemistry, immunoprecipitation, western blot pricing
C3392 Monoclonal Anti-Caspase 4 antibody produced in mouse ~2 mg/mL, clone CAS4, purified immunoglobulin, buffered aqueous solution monkey, human
ELISA, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001225 Rosetta Predictions human pricing
NM_033306 Rosetta Predictions human pricing
NM_053736 Rosetta Predictions rat pricing
NM_007609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066187 predicted 1026
2 SASI_Hs02_00331382 predicted 1020
3 SASI_Hs01_00066188 predicted 578
4 SASI_Hs01_00066189 predicted 1023
5 SASI_Hs02_00331383 predicted 576
6 SASI_Hs02_00331384 predicted 413
7 SASI_Hs01_00066193 predicted 565
8 SASI_Hs01_00066194 predicted 911
9 SASI_Hs02_00331385 predicted 516
10 SASI_Hs02_00331386 predicted 551
11 SASI_Hs01_00066190 predicted 936
12 SASI_Hs01_00066191 predicted 926
13 SASI_Hs01_00066192 predicted 728
14 SASI_Hs01_00066195 predicted 565
15 SASI_Hs01_00066196 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023733 predicted 1056
2 SASI_Hs02_00361143 predicted 1055
3 SASI_Hs01_00023734 predicted 612
4 SASI_Hs01_00023735 predicted 1057
5 SASI_Hs02_00361144 predicted 611
6 SASI_Hs02_00361145 predicted 450
7 SASI_Hs01_00023739 predicted 589
8 SASI_Hs01_00023740 predicted 951
9 SASI_Hs02_00361146 predicted 557
10 SASI_Hs02_00361147 predicted 582
11 SASI_Hs01_00023736 predicted 961
12 SASI_Hs01_00023737 predicted 963
13 SASI_Hs01_00023738 predicted 754
14 SASI_Hs01_00023741 predicted 603
15 SASI_Hs01_00023742 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059157 predicted 407
2 SASI_Rn01_00059158 predicted 607
3 SASI_Rn01_00059159 predicted 471
4 SASI_Rn01_00059160 predicted 951
5 SASI_Rn01_00059161 predicted 685
6 SASI_Rn01_00059162 predicted 735
7 SASI_Rn01_00059163 predicted 595
8 SASI_Rn01_00059164 predicted 394
9 SASI_Rn01_00059165 predicted 352
10 SASI_Rn02_00266518 predicted 379
11 SASI_Rn01_00059156 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176950 predicted 649
2 SASI_Mm01_00176951 predicted 391
3 SASI_Mm01_00176952 predicted 515
4 SASI_Mm01_00176953 predicted 337
5 SASI_Mm01_00176954 predicted 987
6 SASI_Mm01_00176955 predicted 708
7 SASI_Mm01_00176956 predicted 772
8 SASI_Mm01_00176957 predicted 901
9 SASI_Mm01_00176958 predicted 431
10 SASI_Mm01_00176959 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007609
VALIDATED
CASP4 MISSION shRNA Bacterial Glycerol Stock
caspase 4, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-1066s21c1
Sequence:CCGGCTGAAGGTGCAACAATCATTTCTCGAGAAATGATTGTTGCACCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-779s21c1
Sequence:CCGGACAAACCCAAAGTCATCATTGCTCGAGCAATGATGACTTTGGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-714s21c1
Sequence:CCGGAGATGTGCTACAGTATGATACCTCGAGGTATCATACTGTAGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-998s21c1
Sequence:CCGGACTTCATCACTAGACTCATTTCTCGAGAAATGAGTCTAGTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1170s1c1
Sequence:CCGGAGCAACTGAATCTCATTTCTTCTCGAGAAGAAATGAGATTCAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-353s1c1
Sequence:CCGGCCTGAAGAGTTCACAAGGCTTCTCGAGAAGCCTTGTGAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1112s1c1
Sequence:CCGGCGGGCAACCTTGACAAGATATCTCGAGATATCTTGTCAAGGTTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-421s1c1
Sequence:CCGGCCGTACACGAAAGGCTCTTATCTCGAGATAAGAGCCTTTCGTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1026s1c1
Sequence:CCGGGCTCTTGTCATCTCTTTGATACTCGAGTATCAAAGAGATGACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007609
VALIDATED
CASP4 MISSION shRNA shRNA Plasmid DNA
caspase 4, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-1066s21c1
Sequence:CCGGCTGAAGGTGCAACAATCATTTCTCGAGAAATGATTGTTGCACCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-779s21c1
Sequence:CCGGACAAACCCAAAGTCATCATTGCTCGAGCAATGATGACTTTGGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-714s21c1
Sequence:CCGGAGATGTGCTACAGTATGATACCTCGAGGTATCATACTGTAGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-998s21c1
Sequence:CCGGACTTCATCACTAGACTCATTTCTCGAGAAATGAGTCTAGTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1170s1c1
Sequence:CCGGAGCAACTGAATCTCATTTCTTCTCGAGAAGAAATGAGATTCAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-353s1c1
Sequence:CCGGCCTGAAGAGTTCACAAGGCTTCTCGAGAAGCCTTGTGAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1112s1c1
Sequence:CCGGCGGGCAACCTTGACAAGATATCTCGAGATATCTTGTCAAGGTTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-421s1c1
Sequence:CCGGCCGTACACGAAAGGCTCTTATCTCGAGATAAGAGCCTTTCGTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1026s1c1
Sequence:CCGGGCTCTTGTCATCTCTTTGATACTCGAGTATCAAAGAGATGACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007609
VALIDATED
CASP4 MISSION shRNA Lentiviral Transduction Particles
caspase 4, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-1066s21c1
Sequence:CCGGCTGAAGGTGCAACAATCATTTCTCGAGAAATGATTGTTGCACCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-779s21c1
Sequence:CCGGACAAACCCAAAGTCATCATTGCTCGAGCAATGATGACTTTGGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-714s21c1
Sequence:CCGGAGATGTGCTACAGTATGATACCTCGAGGTATCATACTGTAGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007609.2-998s21c1
Sequence:CCGGACTTCATCACTAGACTCATTTCTCGAGAAATGAGTCTAGTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1170s1c1
Sequence:CCGGAGCAACTGAATCTCATTTCTTCTCGAGAAGAAATGAGATTCAGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-353s1c1
Sequence:CCGGCCTGAAGAGTTCACAAGGCTTCTCGAGAAGCCTTGTGAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1112s1c1
Sequence:CCGGCGGGCAACCTTGACAAGATATCTCGAGATATCTTGTCAAGGTTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-421s1c1
Sequence:CCGGCCGTACACGAAAGGCTCTTATCTCGAGATAAGAGCCTTTCGTGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007609.1-1026s1c1
Sequence:CCGGGCTCTTGTCATCTCTTTGATACTCGAGTATCAAAGAGATGACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001225
CASP4 MISSION shRNA Bacterial Glycerol Stock
caspase 4, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-1016s21c1
Sequence:CCGGGACAGCACAATGGGCTCTATCCTCGAGGATAGAGCCCATTGTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-235s21c1
Sequence:CCGGTCGGGTCATGGCAGACTCTATCTCGAGATAGAGTCTGCCATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-387s1c1
Sequence:CCGGAGACTATGTAAAGAAAGAGCTCTCGAGAGCTCTTTCTTTACATAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-225s1c1
Sequence:CCGGCAAGAGAAGCAACGTATGGCACTCGAGTGCCATACGTTGCTTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-492s1c1
Sequence:CCGGCCGAGGAATGGAGCTGACTTTCTCGAGAAAGTCAGCTCCATTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001225.x-1223s1c1
Sequence:CCGGGCACCTTCATTAGTACAGCTTCTCGAGAAGCTGTACTAATGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-233s1c1
Sequence:CCGGGCAACGTATGGCAGGACAAATCTCGAGATTTGTCCTGCCATACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001225
CASP4 MISSION shRNA shRNA Plasmid DNA
caspase 4, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-1016s21c1
Sequence:CCGGGACAGCACAATGGGCTCTATCCTCGAGGATAGAGCCCATTGTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-235s21c1
Sequence:CCGGTCGGGTCATGGCAGACTCTATCTCGAGATAGAGTCTGCCATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-387s1c1
Sequence:CCGGAGACTATGTAAAGAAAGAGCTCTCGAGAGCTCTTTCTTTACATAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-225s1c1
Sequence:CCGGCAAGAGAAGCAACGTATGGCACTCGAGTGCCATACGTTGCTTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-492s1c1
Sequence:CCGGCCGAGGAATGGAGCTGACTTTCTCGAGAAAGTCAGCTCCATTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001225.x-1223s1c1
Sequence:CCGGGCACCTTCATTAGTACAGCTTCTCGAGAAGCTGTACTAATGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-233s1c1
Sequence:CCGGGCAACGTATGGCAGGACAAATCTCGAGATTTGTCCTGCCATACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001225
CASP4 MISSION shRNA Lentiviral Transduction Particles
caspase 4, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-1016s21c1
Sequence:CCGGGACAGCACAATGGGCTCTATCCTCGAGGATAGAGCCCATTGTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001225.3-235s21c1
Sequence:CCGGTCGGGTCATGGCAGACTCTATCTCGAGATAGAGTCTGCCATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-387s1c1
Sequence:CCGGAGACTATGTAAAGAAAGAGCTCTCGAGAGCTCTTTCTTTACATAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-225s1c1
Sequence:CCGGCAAGAGAAGCAACGTATGGCACTCGAGTGCCATACGTTGCTTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-492s1c1
Sequence:CCGGCCGAGGAATGGAGCTGACTTTCTCGAGAAAGTCAGCTCCATTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001225.x-1223s1c1
Sequence:CCGGGCACCTTCATTAGTACAGCTTCTCGAGAAGCTGTACTAATGAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001225.x-233s1c1
Sequence:CCGGGCAACGTATGGCAGGACAAATCTCGAGATTTGTCCTGCCATACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks