EMAIL THIS PAGE TO A FRIEND

CASP5

caspase 5, apoptosis-related cysteine peptidase

31 Gene Product Result for
Synonyms: ICE(rel)III ICEREL-III ICH-3
Species: Human CASP5(838)
Gene ID:
Human(838) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127011 MISSION® esiRNA esiRNA human CASP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337410 predicted 1013
2 SASI_Hs01_00113218 predicted 1150
3 SASI_Hs01_00113219 predicted 1154
4 SASI_Hs02_00337411 predicted 1027
5 SASI_Hs02_00337412 predicted 1010
6 SASI_Hs01_00113222 predicted 1065
7 SASI_Hs01_00113224 predicted 1041
8 SASI_Hs01_00113223 predicted 1110
9 SASI_Hs01_00113225 predicted 503
10 SASI_Hs01_00113226 predicted 1391
11 SASI_Hs01_00113217 predicted 971
12 SASI_Hs01_00113220 predicted 984
13 SASI_Hs01_00113221 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004347
CASP5 MISSION shRNA Bacterial Glycerol Stock
caspase 5, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-381s1c1
Sequence:CCGGCACTTCTCAATATGGACCAAACTCGAGTTTGGTCCATATTGAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1122s1c1
Sequence:CCGGTCATTACGGAACTCATCACATCTCGAGATGTGATGAGTTCCGTAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-190s1c1
Sequence:CCGGAGTTAAGATGTTGGAATACCTCTCGAGAGGTATTCCAACATCTTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1237s1c1
Sequence:CCGGCACCATAGAACGAGCAACCTTCTCGAGAAGGTTGCTCGTTCTATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-349s1c1
Sequence:CCGGGAATCGCGTGGCTCATCAAATCTCGAGATTTGATGAGCCACGCGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-106s21c1
Sequence:CCGGGATTGGATAACTTCGTGATAACTCGAGTTATCACGAAGTTATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-1212s21c1
Sequence:CCGGTGCCACCTAATGGAAATATTTCTCGAGAAATATTTCCATTAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004347
CASP5 MISSION shRNA shRNA Plasmid DNA
caspase 5, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-381s1c1
Sequence:CCGGCACTTCTCAATATGGACCAAACTCGAGTTTGGTCCATATTGAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1122s1c1
Sequence:CCGGTCATTACGGAACTCATCACATCTCGAGATGTGATGAGTTCCGTAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-190s1c1
Sequence:CCGGAGTTAAGATGTTGGAATACCTCTCGAGAGGTATTCCAACATCTTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1237s1c1
Sequence:CCGGCACCATAGAACGAGCAACCTTCTCGAGAAGGTTGCTCGTTCTATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-349s1c1
Sequence:CCGGGAATCGCGTGGCTCATCAAATCTCGAGATTTGATGAGCCACGCGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-106s21c1
Sequence:CCGGGATTGGATAACTTCGTGATAACTCGAGTTATCACGAAGTTATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-1212s21c1
Sequence:CCGGTGCCACCTAATGGAAATATTTCTCGAGAAATATTTCCATTAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004347
CASP5 MISSION shRNA Lentiviral Transduction Particles
caspase 5, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-381s1c1
Sequence:CCGGCACTTCTCAATATGGACCAAACTCGAGTTTGGTCCATATTGAGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1122s1c1
Sequence:CCGGTCATTACGGAACTCATCACATCTCGAGATGTGATGAGTTCCGTAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-190s1c1
Sequence:CCGGAGTTAAGATGTTGGAATACCTCTCGAGAGGTATTCCAACATCTTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-1237s1c1
Sequence:CCGGCACCATAGAACGAGCAACCTTCTCGAGAAGGTTGCTCGTTCTATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004347.x-349s1c1
Sequence:CCGGGAATCGCGTGGCTCATCAAATCTCGAGATTTGATGAGCCACGCGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-106s21c1
Sequence:CCGGGATTGGATAACTTCGTGATAACTCGAGTTATCACGAAGTTATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004347.3-1212s21c1
Sequence:CCGGTGCCACCTAATGGAAATATTTCTCGAGAAATATTTCCATTAGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks