EMAIL THIS PAGE TO A FRIEND

CASP6

caspase 6, apoptosis-related cysteine peptidase

94 Gene Product Result for
Synonyms: MCH2
UniProtKB ID: P55212, Q9BQE7
Gene ID:
Human(839) Summary: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein is processed by caspases 7, 8 and 10, and is thought to function as a downstream enzyme in the caspase activation cascade. Alternative splicing of this gene results in two transcript variants that encode different isoforms. [provided by RefSeq, Jul 2008]
Mouse(12368) caspase 6
Rat(83584) caspase 6
Zebrafish(552927) caspase 6, apoptosis-related cysteine peptidase
dog(487899) caspase 6, apoptosis-related cysteine peptidase
cow(538409) caspase 6, apoptosis-related cysteine peptidase
domestic cat(768261) caspase 6, apoptosis-related cysteine peptidase
chicken(395477) caspase 6, apoptosis-related cysteine peptidase
domestic guinea pig(100713360) caspase 6, apoptosis-related cysteine peptidase
naked mole-rat(101707090) caspase 6, apoptosis-related cysteine peptidase
sheep(101119820) caspase 6, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500330 Anti-CASP6 (Cleaved-Asp162) antibody produced in rabbit affinity isolated antibody mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503309 Anti-CASP6 (Cleaved-Asp162) antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunohistochemistry, western blot pricing
HPA011337 Anti-CASP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA024303 Anti-CASP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503308 Anti-CASP6, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C7599 Anti-Caspase 6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
SAB3500402 Anti-Caspase-6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
SAB4503805 Anti-phospho-Caspase 6 (pSer257) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306300 ANTI-PHOSPHO-CASPASE 6(S257) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009061 MISSION® esiRNA esiRNA targeting mouse Casp6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001226 Rosetta Predictions human pricing
NM_032992 Rosetta Predictions human pricing
NM_031775 Rosetta Predictions rat pricing
NM_009811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019062 predicted 759
2 SASI_Hs01_00019063 predicted 202
3 SASI_Hs01_00019064 predicted 319
4 SASI_Hs01_00019065 predicted 752
5 SASI_Hs01_00019066 predicted 354
6 SASI_Hs01_00019067 predicted 589
7 SASI_Hs01_00019068 predicted 718
8 SASI_Hs01_00019070 predicted 735
9 SASI_Hs02_00331387 predicted 208
10 SASI_Hs02_00331388 predicted 624
11 SASI_Hs01_00019069 predicted 338
12 SASI_Hs01_00019071 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164124 predicted 495
2 SASI_Hs02_00360626 predicted 545
3 SASI_Hs02_00360627 predicted 553
4 SASI_Hs02_00360628 predicted 475
5 SASI_Hs01_00164116 predicted 479
6 SASI_Hs02_00360629 predicted 449
7 SASI_Hs02_00360630 predicted 381
8 SASI_Hs02_00360631 predicted 438
9 SASI_Hs02_00360632 predicted 467
10 SASI_Hs02_00360633 predicted 444
11 SASI_Hs01_00164117 predicted 480
12 SASI_Hs01_00164118 predicted 491
13 SASI_Hs01_00164119 predicted 478
14 SASI_Hs01_00164120 predicted 488
15 SASI_Hs01_00164121 predicted 487
16 SASI_Hs01_00164122 predicted 483
17 SASI_Hs01_00164123 predicted 479
18 SASI_Hs01_00164125 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104197 predicted 1297
2 SASI_Rn01_00104198 predicted 1268
3 SASI_Rn01_00104199 predicted 1210
4 SASI_Rn01_00104200 predicted 376
5 SASI_Rn02_00265211 predicted 795
6 SASI_Rn01_00104201 predicted 598
7 SASI_Rn01_00104203 predicted 771
8 SASI_Rn01_00104204 predicted 1206
9 SASI_Rn01_00104206 predicted 271
10 SASI_Rn02_00265212 predicted 1221
11 SASI_Rn01_00104202 predicted 755
12 SASI_Rn01_00104205 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079669 predicted 706
2 SASI_Mm02_00317095 predicted 1214
3 SASI_Mm02_00317096 predicted 681
4 SASI_Mm02_00317097 predicted 1113
5 SASI_Mm02_00317098 predicted 676
6 SASI_Mm01_00079676 predicted 581
7 SASI_Mm02_00317099 predicted 696
8 SASI_Mm01_00079678 predicted 348
9 SASI_Mm02_00317100 predicted 649
10 SASI_Mm02_00317101 predicted 732
11 SASI_Mm01_00079670 predicted 857
12 SASI_Mm01_00079671 predicted 253
13 SASI_Mm01_00079672 predicted 676
14 SASI_Mm01_00079673 predicted 308
15 SASI_Mm01_00079674 predicted 197
16 SASI_Mm01_00079675 predicted 380
17 SASI_Mm01_00079677 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001226
VALIDATED
CASP6 MISSION shRNA Bacterial Glycerol Stock
caspase 6, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-441s21c1
Sequence:CCGGTGGCGAAGGCAATCACATTTACTCGAGTAAATGTGATTGCCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-626s21c1
Sequence:CCGGAGAAGTTGGACACCAACATAACTCGAGTTATGTTGGTGTCCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-691s1c1
Sequence:CCGGGACTTCCTCATGTGTTACTCTCTCGAGAGAGTAACACATGAGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-697s1c1
Sequence:CCGGCTCATGTGTTACTCTGTTGCACTCGAGTGCAACAGAGTAACACATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-1338s1c1
Sequence:CCGGGTTAGGGTGAAGCATTATGGTCTCGAGACCATAATGCTTCACCCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-598s1c1
Sequence:CCGGCCTTTGGATGTAGTAGATAATCTCGAGATTATCTACTACATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-416s1c1
Sequence:CCGGGCTTTGTGTGTGTCTTCCTGACTCGAGTCAGGAAGACACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001226
VALIDATED
CASP6 MISSION shRNA shRNA Plasmid DNA
caspase 6, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-441s21c1
Sequence:CCGGTGGCGAAGGCAATCACATTTACTCGAGTAAATGTGATTGCCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-626s21c1
Sequence:CCGGAGAAGTTGGACACCAACATAACTCGAGTTATGTTGGTGTCCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-691s1c1
Sequence:CCGGGACTTCCTCATGTGTTACTCTCTCGAGAGAGTAACACATGAGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-697s1c1
Sequence:CCGGCTCATGTGTTACTCTGTTGCACTCGAGTGCAACAGAGTAACACATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-1338s1c1
Sequence:CCGGGTTAGGGTGAAGCATTATGGTCTCGAGACCATAATGCTTCACCCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-598s1c1
Sequence:CCGGCCTTTGGATGTAGTAGATAATCTCGAGATTATCTACTACATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-416s1c1
Sequence:CCGGGCTTTGTGTGTGTCTTCCTGACTCGAGTCAGGAAGACACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001226
VALIDATED
CASP6 MISSION shRNA Lentiviral Transduction Particles
caspase 6, apoptosis-related cysteine peptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-441s21c1
Sequence:CCGGTGGCGAAGGCAATCACATTTACTCGAGTAAATGTGATTGCCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001226.3-626s21c1
Sequence:CCGGAGAAGTTGGACACCAACATAACTCGAGTTATGTTGGTGTCCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-691s1c1
Sequence:CCGGGACTTCCTCATGTGTTACTCTCTCGAGAGAGTAACACATGAGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-697s1c1
Sequence:CCGGCTCATGTGTTACTCTGTTGCACTCGAGTGCAACAGAGTAACACATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-1338s1c1
Sequence:CCGGGTTAGGGTGAAGCATTATGGTCTCGAGACCATAATGCTTCACCCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001226.x-598s1c1
Sequence:CCGGCCTTTGGATGTAGTAGATAATCTCGAGATTATCTACTACATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001226.x-416s1c1
Sequence:CCGGGCTTTGTGTGTGTCTTCCTGACTCGAGTCAGGAAGACACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009811
VALIDATED
CASP6 MISSION shRNA Bacterial Glycerol Stock
caspase 6, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-839s21c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-149s21c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-715s21c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-377s21c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-338s1c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-800s1c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-676s1c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-110s1c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009811.2-1069s1c1
Sequence:CCGGCCTCAGGAAATTACTATGCATCTCGAGATGCATAGTAATTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009811
VALIDATED
CASP6 MISSION shRNA shRNA Plasmid DNA
caspase 6, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-839s21c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-149s21c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-715s21c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-377s21c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-338s1c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-800s1c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-676s1c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-110s1c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009811.2-1069s1c1
Sequence:CCGGCCTCAGGAAATTACTATGCATCTCGAGATGCATAGTAATTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009811
VALIDATED
CASP6 MISSION shRNA Lentiviral Transduction Particles
caspase 6, apoptosis-related cysteine peptidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-839s21c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-149s21c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-715s21c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009811.3-377s21c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-338s1c1
Sequence:CCGGCGATTGCTTCATCTGTGTCTTCTCGAGAAGACACAGATGAAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-800s1c1
Sequence:CCGGCCCGGATGCAATCGGCAAGAACTCGAGTTCTTGCCGATTGCATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-676s1c1
Sequence:CCGGGCTCCTGGTACATTCAGGATTCTCGAGAATCCTGAATGTACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009811.2-110s1c1
Sequence:CCGGGCAGTACAAGATGGACCACAACTCGAGTTGTGGTCCATCTTGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009811.2-1069s1c1
Sequence:CCGGCCTCAGGAAATTACTATGCATCTCGAGATGCATAGTAATTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks