EMAIL THIS PAGE TO A FRIEND

CASP7

caspase 7, apoptosis-related cysteine peptidase

135 Gene Product Result for
Synonyms: CASP-7 CMH-1 ICE-LAP3 LICE2 MCH3
Gene ID:
Human(840) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(12369) caspase 7
Rat(64026) caspase 7
Zebrafish(553634) caspase 7, apoptosis-related cysteine peptidase
dog(486896) caspase 7, apoptosis-related cysteine peptidase
domestic cat(768262) caspase 7, apoptosis-related cysteine peptidase
cow(526279) caspase 7, apoptosis-related cysteine peptidase
chicken(423901) caspase 7, apoptosis-related cysteine peptidase
Goat(100861343) caspase 7, apoptosis-related cysteine peptidase
sheep(101122741) caspase 7, apoptosis-related cysteine peptidase
naked mole-rat(101709568) caspase 7, apoptosis-related cysteine peptidase
domestic guinea pig(100715159) caspase 7, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A0835 N-Acetyl-Asp-Glu-Val-Asp-al ≥95%, powder human pricing
N1413 NSCI ≥97% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001227 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090761 MISSION® esiRNA esiRNA human CASP7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001227 Rosetta Predictions human pricing
NM_033338 Rosetta Predictions human pricing
NM_033339 Rosetta Predictions human pricing
NM_033340 Rosetta Predictions human pricing
NM_022260 Rosetta Predictions rat pricing
NM_007611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128361 predicted 1476
2 SASI_Hs01_00128362 predicted 1284
3 SASI_Hs02_00331389 predicted 1238
4 SASI_Hs01_00128363 predicted 1471
5 SASI_Hs01_00128364 predicted 1248
6 SASI_Hs01_00128365 predicted 1332
7 SASI_Hs01_00128366 predicted 1193
8 SASI_Hs01_00128367 predicted 1113
9 SASI_Hs01_00128368 predicted 1250
10 SASI_Hs01_00128369 predicted 1255
11 SASI_Hs01_00128370 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091255 predicted 1576
2 SASI_Hs01_00091256 predicted 1390
3 SASI_Hs02_00361187 predicted 1343
4 SASI_Hs01_00091257 predicted 1579
5 SASI_Hs01_00091258 predicted 1361
6 SASI_Hs01_00091259 predicted 1445
7 SASI_Hs01_00091260 predicted 1306
8 SASI_Hs01_00091261 predicted 1212
9 SASI_Hs01_00091262 predicted 1348
10 SASI_Hs01_00091263 predicted 1364
11 SASI_Hs01_00091264 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202476 predicted 1550
2 SASI_Hs01_00202477 predicted 1357
3 SASI_Hs02_00361188 predicted 1307
4 SASI_Hs01_00202478 predicted 1541
5 SASI_Hs01_00202479 predicted 1326
6 SASI_Hs01_00202480 predicted 1412
7 SASI_Hs01_00202481 predicted 1274
8 SASI_Hs01_00202482 predicted 1182
9 SASI_Hs01_00202483 predicted 1321
10 SASI_Hs01_00202484 predicted 1329
11 SASI_Hs01_00202485 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140467 predicted 1299
2 SASI_Hs01_00140468 predicted 1114
3 SASI_Hs02_00361189 predicted 1060
4 SASI_Hs01_00140469 predicted 1293
5 SASI_Hs01_00140470 predicted 1077
6 SASI_Hs01_00140471 predicted 1165
7 SASI_Hs01_00140472 predicted 1023
8 SASI_Hs01_00140473 predicted 939
9 SASI_Hs01_00140474 predicted 1069
10 SASI_Hs01_00140475 predicted 1090
11 SASI_Hs01_00140476 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107595 predicted 432
2 SASI_Rn01_00107596 predicted 198
3 SASI_Rn01_00107597 predicted 860
4 SASI_Rn02_00263055 predicted 288
5 SASI_Rn01_00107598 predicted 811
6 SASI_Rn01_00107599 predicted 230
7 SASI_Rn01_00107600 predicted 431
8 SASI_Rn01_00107601 predicted 324
9 SASI_Rn01_00107602 predicted 635
10 SASI_Rn01_00107603 predicted 1373
11 SASI_Rn01_00107604 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134240 predicted 380
2 SASI_Mm01_00134241 predicted 351
3 SASI_Mm01_00134242 predicted 514
4 SASI_Mm01_00134243 predicted 534
5 SASI_Mm01_00134244 predicted 371
6 SASI_Mm01_00134245 predicted 1524
7 SASI_Mm01_00134246 predicted 1516
8 SASI_Mm02_00312063 predicted 282
9 SASI_Mm01_00134248 predicted 426
10 SASI_Mm01_00134249 predicted 1597
11 SASI_Mm01_00134247 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007611
VALIDATED
CASP7 MISSION shRNA Bacterial Glycerol Stock
caspase 7, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007611.1-476s1c1
Sequence:CCGGCCCTCTTCAAGTGCTTCCAAACTCGAGTTTGGAAGCACTTGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-631s1c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-1128s1c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-863s1c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-863s21c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-369s21c1
Sequence:CCGGCCGCATGGATTTCCAGAAGATCTCGAGATCTTCTGGAAATCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007611.2-1128s21c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-631s21c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007611
VALIDATED
CASP7 MISSION shRNA shRNA Plasmid DNA
caspase 7, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007611.1-476s1c1
Sequence:CCGGCCCTCTTCAAGTGCTTCCAAACTCGAGTTTGGAAGCACTTGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-631s1c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-1128s1c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-863s1c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-863s21c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-369s21c1
Sequence:CCGGCCGCATGGATTTCCAGAAGATCTCGAGATCTTCTGGAAATCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007611.2-1128s21c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-631s21c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007611
VALIDATED
CASP7 MISSION shRNA Lentiviral Transduction Particles
caspase 7, apoptosis-related cysteine peptidase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007611.1-476s1c1
Sequence:CCGGCCCTCTTCAAGTGCTTCCAAACTCGAGTTTGGAAGCACTTGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-631s1c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-1128s1c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007611.1-863s1c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-863s21c1
Sequence:CCGGCGGTTCCAGGTTATTACTCATCTCGAGATGAGTAATAACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-369s21c1
Sequence:CCGGCCGCATGGATTTCCAGAAGATCTCGAGATCTTCTGGAAATCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007611.2-1128s21c1
Sequence:CCGGCGTTCGTTGATGAATCCAGTTCTCGAGAACTGGATTCATCAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007611.2-631s21c1
Sequence:CCGGGACCTGATTTACGGGAAAGATCTCGAGATCTTTCCCGTAAATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001227
VALIDATED
CASP7 MISSION shRNA Bacterial Glycerol Stock
caspase 7, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-791s1c1
Sequence:CCGGAGGATTTGACAGCCCACTTTACTCGAGTAAAGTGGGCTGTCAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001227.x-2235s1c1
Sequence:CCGGGTAATCACTAATGCTCAACAACTCGAGTTGTTGAGCATTAGTGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-961s1c1
Sequence:CCGGGCTGACTTCCTCTTCGCCTATCTCGAGATAGGCGAAGAGGAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-398s1c1
Sequence:CCGGCCTCGTTTGTACCGTCCCTCTCTCGAGAGAGGGACGGTACAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-724s1c1
Sequence:CCGGGCCTGCATCCTCTTAAGCCATCTCGAGATGGCTTAAGAGGATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-719s21c1
Sequence:CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001227.3-509s21c1
Sequence:CCGGAGCTGGGCAAATGCATCATAACTCGAGTTATGATGCATTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-1465s21c1
Sequence:CCGGGTATGTCTGTTACCTTGTTAACTCGAGTTAACAAGGTAACAGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-628s21c1
Sequence:CCGGTTTGACGTGATTGTCTATAATCTCGAGATTATAGACAATCACGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001227
VALIDATED
CASP7 MISSION shRNA shRNA Plasmid DNA
caspase 7, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-791s1c1
Sequence:CCGGAGGATTTGACAGCCCACTTTACTCGAGTAAAGTGGGCTGTCAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001227.x-2235s1c1
Sequence:CCGGGTAATCACTAATGCTCAACAACTCGAGTTGTTGAGCATTAGTGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-961s1c1
Sequence:CCGGGCTGACTTCCTCTTCGCCTATCTCGAGATAGGCGAAGAGGAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-398s1c1
Sequence:CCGGCCTCGTTTGTACCGTCCCTCTCTCGAGAGAGGGACGGTACAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-724s1c1
Sequence:CCGGGCCTGCATCCTCTTAAGCCATCTCGAGATGGCTTAAGAGGATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-719s21c1
Sequence:CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001227.3-509s21c1
Sequence:CCGGAGCTGGGCAAATGCATCATAACTCGAGTTATGATGCATTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-1465s21c1
Sequence:CCGGGTATGTCTGTTACCTTGTTAACTCGAGTTAACAAGGTAACAGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-628s21c1
Sequence:CCGGTTTGACGTGATTGTCTATAATCTCGAGATTATAGACAATCACGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001227
VALIDATED
CASP7 MISSION shRNA Lentiviral Transduction Particles
caspase 7, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-791s1c1
Sequence:CCGGAGGATTTGACAGCCCACTTTACTCGAGTAAAGTGGGCTGTCAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001227.x-2235s1c1
Sequence:CCGGGTAATCACTAATGCTCAACAACTCGAGTTGTTGAGCATTAGTGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-961s1c1
Sequence:CCGGGCTGACTTCCTCTTCGCCTATCTCGAGATAGGCGAAGAGGAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-398s1c1
Sequence:CCGGCCTCGTTTGTACCGTCCCTCTCTCGAGAGAGGGACGGTACAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001227.x-724s1c1
Sequence:CCGGGCCTGCATCCTCTTAAGCCATCTCGAGATGGCTTAAGAGGATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-719s21c1
Sequence:CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001227.3-509s21c1
Sequence:CCGGAGCTGGGCAAATGCATCATAACTCGAGTTATGATGCATTTGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-1465s21c1
Sequence:CCGGGTATGTCTGTTACCTTGTTAACTCGAGTTAACAAGGTAACAGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001227.3-628s21c1
Sequence:CCGGTTTGACGTGATTGTCTATAATCTCGAGATTATAGACAATCACGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks