EMAIL THIS PAGE TO A FRIEND

CASP8

caspase 8, apoptosis-related cysteine peptidase

265 Gene Product Result for
Synonyms: ALPS2B CAP4 Casp-8 FLICE MACH MCH5
Gene ID:
Human(841) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008]
Mouse(12370) caspase 8
Rat(64044) caspase 8
domestic guinea pig(100713334) caspase 8, apoptosis-related cysteine peptidase
naked mole-rat(101702773) caspase 8, apoptosis-related cysteine peptidase
sheep(101107334) caspase 8, apoptosis-related cysteine peptidase
Zebrafish(58022) caspase 8, apoptosis-related cysteine peptidase
domestic cat(100142684) caspase 8, apoptosis-related cysteine peptidase
cow(507481) caspase 8, apoptosis-related cysteine peptidase
Horse(100066502) caspase 8, apoptosis-related cysteine peptidase
dog(488473) caspase 8, apoptosis-related cysteine peptidase
chicken(395284) caspase 8, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503321 Anti-CASP8 (Cleaved-Asp384), C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA001302 Anti-CASP8 antibody produced in rabbit Ab3, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA005688 Anti-CASP8 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA006191 Anti-CASP8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
C2976 Anti-Caspase 8 (GD-13) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
C3101 Anti-Caspase 8 (SK-16) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
GW21154 Anti-Caspase 8 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
C4106 Anti-Caspase 8 antibody, Mouse monoclonal clone CAS8, purified from hybridoma cell culture human
ELISA, microarray, western blot pricing
SAB3500404 Anti-Caspase-8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, western blot pricing
SAB4503806 Anti-phospho-Caspase 8 (pSer347) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504574 Anti-phospho-Caspase 8 (pTyr380) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
C7849 Anti-pro-Caspase 8 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
SAB5300353 Monoclonal Anti-CASP8 antibody produced in mouse clone 1H11, ascites fluid mouse, rat, monkey, human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

Activity Assay

Product # Description Species Add to Cart
 
CASP8C Caspase 8 Assay Kit, Colorimetric human pricing
CASP8F Caspase 8 Assay Kit, Fluorimetric human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080124 Rosetta Predictions human pricing
NM_001080125 Rosetta Predictions human pricing
NM_001228 Rosetta Predictions human pricing
NM_033355 Rosetta Predictions human pricing
NM_033356 Rosetta Predictions human pricing
NM_033358 Rosetta Predictions human pricing
NM_022277 Rosetta Predictions rat pricing
NM_001080126 Rosetta Predictions mouse pricing
NM_009812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314221 predicted 1199
2 SASI_Hs02_00314222 predicted 1339
3 SASI_Hs02_00314223 predicted 1038
4 SASI_Hs02_00314224 predicted 1320
5 SASI_Hs02_00314225 predicted 1046
6 SASI_Hs02_00314226 predicted 986
7 SASI_Hs02_00314227 predicted 1045
8 SASI_Hs02_00314228 predicted 1285
9 SASI_Hs02_00314229 predicted 1000
10 SASI_Hs02_00314230 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314231 predicted 1384
2 SASI_Hs02_00314232 predicted 1522
3 SASI_Hs02_00314233 predicted 1227
4 SASI_Hs02_00314234 predicted 1507
5 SASI_Hs02_00314235 predicted 1239
6 SASI_Hs02_00314236 predicted 1175
7 SASI_Hs02_00314237 predicted 1230
8 SASI_Hs02_00314238 predicted 1475
9 SASI_Hs02_00314239 predicted 1184
10 SASI_Hs02_00314240 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116510 predicted 1362
2 SASI_Hs02_00331390 predicted 1502
3 SASI_Hs02_00331391 predicted 1203
4 SASI_Hs01_00116515 predicted 1488
5 SASI_Hs02_00331392 predicted 1215
6 SASI_Hs02_00331393 predicted 1153
7 SASI_Hs01_00116517 predicted 1208
8 SASI_Hs01_00116518 predicted 1456
9 SASI_Hs02_00331394 predicted 1163
10 SASI_Hs02_00331395 predicted 1534
11 SASI_Hs01_00116511 predicted 1041
12 SASI_Hs01_00116512 predicted 998
13 SASI_Hs01_00116513 predicted 1238
14 SASI_Hs01_00116514 predicted 1099
15 SASI_Hs01_00116516 predicted 901
16 SASI_Hs01_00116519 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225795 predicted 1212
2 SASI_Hs02_00361202 predicted 1357
3 SASI_Hs02_00361203 predicted 1056
4 SASI_Hs01_00225797 predicted 1342
5 SASI_Hs01_00225798 predicted 1067
6 SASI_Hs02_00361204 predicted 1008
7 SASI_Hs01_00225799 predicted 1067
8 SASI_Hs01_00225800 predicted 1302
9 SASI_Hs01_00225802 predicted 1023
10 SASI_Hs01_00225803 predicted 1380
11 SASI_Hs01_00225796 predicted 1252
12 SASI_Hs01_00225801 predicted 1519
13 SASI_Hs01_00225804 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202376 predicted 1099
2 SASI_Hs02_00361205 predicted 1240
3 SASI_Hs02_00361206 predicted 941
4 SASI_Hs01_00202378 predicted 1226
5 SASI_Hs01_00202379 predicted 957
6 SASI_Hs02_00361207 predicted 895
7 SASI_Hs01_00202380 predicted 947
8 SASI_Hs01_00202381 predicted 1188
9 SASI_Hs01_00202383 predicted 906
10 SASI_Hs01_00202384 predicted 1274
11 SASI_Hs01_00202377 predicted 973
12 SASI_Hs01_00202382 predicted 1249
13 SASI_Hs01_00202385 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111734 predicted 311
2 SASI_Hs01_00111735 predicted 380
3 SASI_Hs01_00111736 predicted 309
4 SASI_Hs02_00361208 predicted 341
5 SASI_Hs01_00111737 predicted 300
6 SASI_Hs01_00111739 predicted 307
7 SASI_Hs01_00111740 predicted 363
8 SASI_Hs01_00111741 predicted 304
9 SASI_Hs01_00111742 predicted 376
10 SASI_Hs02_00361209 predicted 385
11 SASI_Hs01_00111738 predicted 334
12 SASI_Hs01_00111743 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107141 predicted 984
2 SASI_Rn01_00107142 predicted 690
3 SASI_Rn01_00107143 predicted 1610
4 SASI_Rn01_00107144 predicted 693
5 SASI_Rn01_00107145 predicted 1029
6 SASI_Rn02_00263087 predicted 1103
7 SASI_Rn01_00107146 predicted 1131
8 SASI_Rn01_00107147 predicted 1311
9 SASI_Rn02_00263088 predicted 1041
10 SASI_Rn01_00107148 predicted 1172
11 SASI_Rn01_00107149 predicted 427
12 SASI_Rn01_00107150 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293293 predicted 972
2 SASI_Mm02_00293294 predicted 1467
3 SASI_Mm02_00293295 predicted 621
4 SASI_Mm02_00293296 predicted 1169
5 SASI_Mm02_00293297 predicted 931
6 SASI_Mm02_00293298 predicted 1476
7 SASI_Mm02_00293299 predicted 735
8 SASI_Mm02_00293300 predicted 1037
9 SASI_Mm02_00293301 predicted 1366
10 SASI_Mm02_00293302 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317102 predicted 1139
2 SASI_Mm02_00317103 predicted 1639
3 SASI_Mm01_00093051 predicted 789
4 SASI_Mm02_00317104 predicted 1351
5 SASI_Mm02_00317105 predicted 1104
6 SASI_Mm02_00317106 predicted 1646
7 SASI_Mm01_00093057 predicted 909
8 SASI_Mm01_00093059 predicted 1206
9 SASI_Mm01_00093060 predicted 1545
10 SASI_Mm02_00317107 predicted 1254
11 SASI_Mm01_00093052 predicted 1416
12 SASI_Mm01_00093053 predicted 946
13 SASI_Mm01_00093054 predicted 951
14 SASI_Mm01_00093055 predicted 1358
15 SASI_Mm01_00093056 predicted 1441
16 SASI_Mm01_00093058 predicted 1525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033356
VALIDATED
CASP8 MISSION shRNA Bacterial Glycerol Stock
caspase 8, apoptosis-related cysteine peptidase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-415s21c1
Sequence:CCGGCACCAGGCAGGGCTCAAATTTCTCGAGAAATTTGAGCCCTGCCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-547s21c1
Sequence:CCGGACATGAACCTGCTGGATATTTCTCGAGAAATATCCAGCAGGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-1218s21c1
Sequence:CCGGTCAGAGGAGCAACCCTATTTACTCGAGTAAATAGGGTTGCTCCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-360s21c1
Sequence:CCGGTTGCTGATTACCTACCTAAACCTCGAGGTTTAGGTAGGTAATCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-1253s21c1
Sequence:CCGGATCACCTCAAACGAGATATATCTCGAGATATATCTCGTTTGAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-329s21c1
Sequence:CCGGGGAGCTGCTCTTCCGAATTAACTCGAGTTAATTCGGAAGAGCAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033356
VALIDATED
CASP8 MISSION shRNA shRNA Plasmid DNA
caspase 8, apoptosis-related cysteine peptidase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-415s21c1
Sequence:CCGGCACCAGGCAGGGCTCAAATTTCTCGAGAAATTTGAGCCCTGCCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-547s21c1
Sequence:CCGGACATGAACCTGCTGGATATTTCTCGAGAAATATCCAGCAGGTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-1218s21c1
Sequence:CCGGTCAGAGGAGCAACCCTATTTACTCGAGTAAATAGGGTTGCTCCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-360s21c1
Sequence:CCGGTTGCTGATTACCTACCTAAACCTCGAGGTTTAGGTAGGTAATCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-1253s21c1
Sequence:CCGGATCACCTCAAACGAGATATATCTCGAGATATATCTCGTTTGAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-329s21c1
Sequence:CCGGGGAGCTGCTCTTCCGAATTAACTCGAGTTAATTCGGAAGAGCAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033356
VALIDATED
CASP8 MISSION shRNA Lentiviral Transduction Particles
caspase 8, apoptosis-related cysteine peptidase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-415s21c1
Sequence:CCGGCACCAGGCAGGGCTCAAATTTCTCGAGAAATTTGAGCCCTGCCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-547s21c1
Sequence:CCGGACATGAACCTGCTGGATATTTCTCGAGAAATATCCAGCAGGTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-1218s21c1
Sequence:CCGGTCAGAGGAGCAACCCTATTTACTCGAGTAAATAGGGTTGCTCCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033356.3-360s21c1
Sequence:CCGGTTGCTGATTACCTACCTAAACCTCGAGGTTTAGGTAGGTAATCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-1253s21c1
Sequence:CCGGATCACCTCAAACGAGATATATCTCGAGATATATCTCGTTTGAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033356.3-329s21c1
Sequence:CCGGGGAGCTGCTCTTCCGAATTAACTCGAGTTAATTCGGAAGAGCAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009812
VALIDATED
CASP8 MISSION shRNA Bacterial Glycerol Stock
caspase 8, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1879s21c1
Sequence:CCGGTTTGTGTGGATGAGTCTAATTCTCGAGAATTAGACTCATCCACACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1724s21c1
Sequence:CCGGTCCTGACTGGCGTGAACTATGCTCGAGCATAGTTCACGCCAGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1645s21c1
Sequence:CCGGGTGAATGGAACCTGGTATATTCTCGAGAATATACCAGGTTCCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1558s21c1
Sequence:CCGGTCATCTCACAAGAACTATATTCTCGAGAATATAGTTCTTGTGAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1056s21c1
Sequence:CCGGACGGACTTCAGACAAAGTTTACTCGAGTAAACTTTGTCTGAAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009812.1-1762s1c1
Sequence:CCGGGTGTGGATGAGTCTAATTTATCTCGAGATAAATTAGACTCATCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1144s1c1
Sequence:CCGGGCAAATGAAATCCACGAGATTCTCGAGAATCTCGTGGATTTCATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1359s1c1
Sequence:CCGGCCAAGGAAGTAACTTCCAGAACTCGAGTTCTGGAAGTTACTTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009812.1-1271s1c1
Sequence:CCGGCCTCCATCTATGACCTGACATCTCGAGATGTCAGGTCATAGATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-658s1c1
Sequence:CCGGCCCAAATGTAAGCTGGAAGATCTCGAGATCTTCCAGCTTACATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009812
VALIDATED
CASP8 MISSION shRNA shRNA Plasmid DNA
caspase 8, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1879s21c1
Sequence:CCGGTTTGTGTGGATGAGTCTAATTCTCGAGAATTAGACTCATCCACACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1724s21c1
Sequence:CCGGTCCTGACTGGCGTGAACTATGCTCGAGCATAGTTCACGCCAGTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1645s21c1
Sequence:CCGGGTGAATGGAACCTGGTATATTCTCGAGAATATACCAGGTTCCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1558s21c1
Sequence:CCGGTCATCTCACAAGAACTATATTCTCGAGAATATAGTTCTTGTGAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1056s21c1
Sequence:CCGGACGGACTTCAGACAAAGTTTACTCGAGTAAACTTTGTCTGAAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009812.1-1762s1c1
Sequence:CCGGGTGTGGATGAGTCTAATTTATCTCGAGATAAATTAGACTCATCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1144s1c1
Sequence:CCGGGCAAATGAAATCCACGAGATTCTCGAGAATCTCGTGGATTTCATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1359s1c1
Sequence:CCGGCCAAGGAAGTAACTTCCAGAACTCGAGTTCTGGAAGTTACTTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009812.1-1271s1c1
Sequence:CCGGCCTCCATCTATGACCTGACATCTCGAGATGTCAGGTCATAGATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-658s1c1
Sequence:CCGGCCCAAATGTAAGCTGGAAGATCTCGAGATCTTCCAGCTTACATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009812
VALIDATED
CASP8 MISSION shRNA Lentiviral Transduction Particles
caspase 8, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1879s21c1
Sequence:CCGGTTTGTGTGGATGAGTCTAATTCTCGAGAATTAGACTCATCCACACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1724s21c1
Sequence:CCGGTCCTGACTGGCGTGAACTATGCTCGAGCATAGTTCACGCCAGTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1645s21c1
Sequence:CCGGGTGAATGGAACCTGGTATATTCTCGAGAATATACCAGGTTCCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1558s21c1
Sequence:CCGGTCATCTCACAAGAACTATATTCTCGAGAATATAGTTCTTGTGAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009812.2-1056s21c1
Sequence:CCGGACGGACTTCAGACAAAGTTTACTCGAGTAAACTTTGTCTGAAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009812.1-1762s1c1
Sequence:CCGGGTGTGGATGAGTCTAATTTATCTCGAGATAAATTAGACTCATCCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1144s1c1
Sequence:CCGGGCAAATGAAATCCACGAGATTCTCGAGAATCTCGTGGATTTCATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-1359s1c1
Sequence:CCGGCCAAGGAAGTAACTTCCAGAACTCGAGTTCTGGAAGTTACTTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009812.1-1271s1c1
Sequence:CCGGCCTCCATCTATGACCTGACATCTCGAGATGTCAGGTCATAGATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009812.1-658s1c1
Sequence:CCGGCCCAAATGTAAGCTGGAAGATCTCGAGATCTTCCAGCTTACATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001228
VALIDATED
CASP8 MISSION shRNA Bacterial Glycerol Stock
caspase 8, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-2065s1c1
Sequence:CCGGCCTGGCCGATGGTACTATTTACTCGAGTAAATAGTACCATCGGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-959s1c1
Sequence:CCGGGAATCACAGACTTTGGACAAACTCGAGTTTGTCCAAAGTCTGTGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-758s1c1
Sequence:CCGGGACATGAACCTGCTGGATATTCTCGAGAATATCCAGCAGGTTCATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-1069s1c1
Sequence:CCGGTCACAGCATTAGGGACAGGAACTCGAGTTCCTGTCCCTAATGCTGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-377s1c1
Sequence:CCGGGCCTTGATGTTATTCCAGAGACTCGAGTCTCTGGAATAACATCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001228
VALIDATED
CASP8 MISSION shRNA shRNA Plasmid DNA
caspase 8, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-2065s1c1
Sequence:CCGGCCTGGCCGATGGTACTATTTACTCGAGTAAATAGTACCATCGGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-959s1c1
Sequence:CCGGGAATCACAGACTTTGGACAAACTCGAGTTTGTCCAAAGTCTGTGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-758s1c1
Sequence:CCGGGACATGAACCTGCTGGATATTCTCGAGAATATCCAGCAGGTTCATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-1069s1c1
Sequence:CCGGTCACAGCATTAGGGACAGGAACTCGAGTTCCTGTCCCTAATGCTGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-377s1c1
Sequence:CCGGGCCTTGATGTTATTCCAGAGACTCGAGTCTCTGGAATAACATCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001228
VALIDATED
CASP8 MISSION shRNA Lentiviral Transduction Particles
caspase 8, apoptosis-related cysteine peptidase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-2065s1c1
Sequence:CCGGCCTGGCCGATGGTACTATTTACTCGAGTAAATAGTACCATCGGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-959s1c1
Sequence:CCGGGAATCACAGACTTTGGACAAACTCGAGTTTGTCCAAAGTCTGTGATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-758s1c1
Sequence:CCGGGACATGAACCTGCTGGATATTCTCGAGAATATCCAGCAGGTTCATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001228.x-1069s1c1
Sequence:CCGGTCACAGCATTAGGGACAGGAACTCGAGTTCCTGTCCCTAATGCTGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001228.x-377s1c1
Sequence:CCGGGCCTTGATGTTATTCCAGAGACTCGAGTCTCTGGAATAACATCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)