EMAIL THIS PAGE TO A FRIEND

CASP8AP2

caspase 8 associated protein 2

107 Gene Product Result for
Synonyms: CED-4 FLASH RIP25
Gene ID:
Human(9994) Summary: This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
Mouse(26885) caspase 8 associated protein 2
Rat(313128) caspase 8 associated protein 2
Zebrafish(541521) CASP8 associated protein 2
cow(505138) caspase 8 associated protein 2
Horse(100065766) caspase 8 associated protein 2
domestic cat(101095416) caspase 8 associated protein 2
dog(481921) caspase 8 associated protein 2
chicken(421810) caspase 8 associated protein 2
sheep(101109100) caspase 8 associated protein 2
Domestic Rabbit(100342805) caspase 8 associated protein 2
naked mole-rat(101700716) caspase 8 associated protein 2
domestic guinea pig(100729800) caspase 8 associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012115 Rosetta Predictions human pricing
NM_001107921 Rosetta Predictions rat pricing
NM_001122978 Rosetta Predictions mouse pricing
NM_011997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343647 predicted 966
2 SASI_Hs01_00152963 predicted 2883
3 SASI_Hs01_00152964 predicted 4425
4 SASI_Hs02_00343648 predicted 5386
5 SASI_Hs02_00343649 predicted 2921
6 SASI_Hs01_00152966 predicted 1145
7 SASI_Hs01_00152967 predicted 853
8 SASI_Hs01_00152968 predicted 1745
9 SASI_Hs01_00152969 predicted 1453
10 SASI_Hs02_00343650 predicted 262
11 SASI_Hs01_00152965 predicted 5261
12 SASI_Hs01_00152970 predicted 5425
13 SASI_Hs01_00152971 predicted 4775
14 SASI_Hs01_00152972 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233595 predicted 877
2 SASI_Rn02_00233596 predicted 3965
3 SASI_Rn02_00233597 predicted 4432
4 SASI_Rn02_00233598 predicted 4932
5 SASI_Rn02_00233599 predicted 5528
6 SASI_Rn02_00233600 predicted 3077
7 SASI_Rn02_00233601 predicted 948
8 SASI_Rn02_00233602 predicted 5358
9 SASI_Rn02_00233603 predicted 933
10 SASI_Rn02_00233604 predicted 2858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309709 predicted 4642
2 SASI_Mm02_00309710 predicted 2525
3 SASI_Mm02_00309711 predicted 2213
4 SASI_Mm02_00309712 predicted 5839
5 SASI_Mm02_00309713 predicted 5543
6 SASI_Mm02_00309714 predicted 2308
7 SASI_Mm02_00309715 predicted 2368
8 SASI_Mm02_00309716 predicted 2685
9 SASI_Mm02_00309717 predicted 5152
10 SASI_Mm02_00309718 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321926 predicted 4892
2 SASI_Mm01_00043214 predicted 2463
3 SASI_Mm02_00321927 predicted 6086
4 SASI_Mm02_00321928 predicted 5788
5 SASI_Mm01_00043216 predicted 2553
6 SASI_Mm02_00321929 predicted 1841
7 SASI_Mm01_00043217 predicted 2614
8 SASI_Mm01_00043218 predicted 2928
9 SASI_Mm01_00043220 predicted 1869
10 SASI_Mm01_00043221 predicted 1469
11 SASI_Mm01_00043215 predicted 1727
12 SASI_Mm01_00043219 predicted 5357
13 SASI_Mm01_00043222 predicted 2851
14 SASI_Mm01_00043223 predicted 2981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011997
VALIDATED
CASP8AP2 MISSION shRNA Bacterial Glycerol Stock
caspase 8 associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011997.1-6363s1c1
Sequence:CCGGCCTGTTATTGGTCAGAATGTTCTCGAGAACATTCTGACCAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-1414s1c1
Sequence:CCGGCCCAAGAATGACGTGAAACATCTCGAGATGTTTCACGTCATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011997.1-637s1c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5774s1c1
Sequence:CCGGCCCAGAGACTTAGTCCCAATTCTCGAGAATTGGGACTAAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5089s1c1
Sequence:CCGGGCCTCAAATAAGGTGGTTCATCTCGAGATGAACCACCTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-5514s21c1
Sequence:CCGGGTATGGGATGCCAGGTAATATCTCGAGATATTACCTGGCATCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-3581s21c1
Sequence:CCGGGGCATAGTTGACCGTTTATTTCTCGAGAAATAAACGGTCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011997.2-6358s21c1
Sequence:CCGGGGTCATTGTGCTTGGTGTATTCTCGAGAATACACCAAGCACAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-2262s21c1
Sequence:CCGGTTGCTTGTGGCACGGAAATTTCTCGAGAAATTTCCGTGCCACAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-677s21c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011997
VALIDATED
CASP8AP2 MISSION shRNA shRNA Plasmid DNA
caspase 8 associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011997.1-6363s1c1
Sequence:CCGGCCTGTTATTGGTCAGAATGTTCTCGAGAACATTCTGACCAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-1414s1c1
Sequence:CCGGCCCAAGAATGACGTGAAACATCTCGAGATGTTTCACGTCATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011997.1-637s1c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5774s1c1
Sequence:CCGGCCCAGAGACTTAGTCCCAATTCTCGAGAATTGGGACTAAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5089s1c1
Sequence:CCGGGCCTCAAATAAGGTGGTTCATCTCGAGATGAACCACCTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-5514s21c1
Sequence:CCGGGTATGGGATGCCAGGTAATATCTCGAGATATTACCTGGCATCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-3581s21c1
Sequence:CCGGGGCATAGTTGACCGTTTATTTCTCGAGAAATAAACGGTCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011997.2-6358s21c1
Sequence:CCGGGGTCATTGTGCTTGGTGTATTCTCGAGAATACACCAAGCACAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-2262s21c1
Sequence:CCGGTTGCTTGTGGCACGGAAATTTCTCGAGAAATTTCCGTGCCACAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-677s21c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011997
VALIDATED
CASP8AP2 MISSION shRNA Lentiviral Transduction Particles
caspase 8 associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011997.1-6363s1c1
Sequence:CCGGCCTGTTATTGGTCAGAATGTTCTCGAGAACATTCTGACCAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-1414s1c1
Sequence:CCGGCCCAAGAATGACGTGAAACATCTCGAGATGTTTCACGTCATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011997.1-637s1c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5774s1c1
Sequence:CCGGCCCAGAGACTTAGTCCCAATTCTCGAGAATTGGGACTAAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011997.1-5089s1c1
Sequence:CCGGGCCTCAAATAAGGTGGTTCATCTCGAGATGAACCACCTTATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-5514s21c1
Sequence:CCGGGTATGGGATGCCAGGTAATATCTCGAGATATTACCTGGCATCCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-3581s21c1
Sequence:CCGGGGCATAGTTGACCGTTTATTTCTCGAGAAATAAACGGTCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011997.2-6358s21c1
Sequence:CCGGGGTCATTGTGCTTGGTGTATTCTCGAGAATACACCAAGCACAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-2262s21c1
Sequence:CCGGTTGCTTGTGGCACGGAAATTTCTCGAGAAATTTCCGTGCCACAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011997.2-677s21c1
Sequence:CCGGCGTAAGGATGAAGAGATAAATCTCGAGATTTATCTCTTCATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012115
CASP8AP2 MISSION shRNA Bacterial Glycerol Stock
caspase 8 associated protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-5641s1c1
Sequence:CCGGGCCAGGATCAAATTGTGATAACTCGAGTTATCACAATTTGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2929s1c1
Sequence:CCGGGCCAATTTACAAATCTGACAACTCGAGTTGTCAGATTTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-520s1c1
Sequence:CCGGCCAGTCTCTTAAGAAGAATATCTCGAGATATTCTTCTTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2834s1c1
Sequence:CCGGCCAGTGTATAATAACAGTCATCTCGAGATGACTGTTATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-4248s1c1
Sequence:CCGGGCGAGTCTATACCAGCTTGTACTCGAGTACAAGCTGGTATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-5331s21c1
Sequence:GTACCGGGATGTTCTGGAGGCAATTTAACTCGAGTTAAATTGCCTCCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-1978s21c1
Sequence:GTACCGGAGAGTCTTCAATGCAAGTTAACTCGAGTTAACTTGCATTGAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012115.2-6159s21c1
Sequence:CCGGTGGGACTCTTAACTGATATTGCTCGAGCAATATCAGTTAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-3536s21c1
Sequence:CCGGGGCATAGTTGATCGTTTATTTCTCGAGAAATAAACGATCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012115
CASP8AP2 MISSION shRNA shRNA Plasmid DNA
caspase 8 associated protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-5641s1c1
Sequence:CCGGGCCAGGATCAAATTGTGATAACTCGAGTTATCACAATTTGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2929s1c1
Sequence:CCGGGCCAATTTACAAATCTGACAACTCGAGTTGTCAGATTTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-520s1c1
Sequence:CCGGCCAGTCTCTTAAGAAGAATATCTCGAGATATTCTTCTTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2834s1c1
Sequence:CCGGCCAGTGTATAATAACAGTCATCTCGAGATGACTGTTATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-4248s1c1
Sequence:CCGGGCGAGTCTATACCAGCTTGTACTCGAGTACAAGCTGGTATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-5331s21c1
Sequence:GTACCGGGATGTTCTGGAGGCAATTTAACTCGAGTTAAATTGCCTCCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-1978s21c1
Sequence:GTACCGGAGAGTCTTCAATGCAAGTTAACTCGAGTTAACTTGCATTGAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012115.2-6159s21c1
Sequence:CCGGTGGGACTCTTAACTGATATTGCTCGAGCAATATCAGTTAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-3536s21c1
Sequence:CCGGGGCATAGTTGATCGTTTATTTCTCGAGAAATAAACGATCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012115
CASP8AP2 MISSION shRNA Lentiviral Transduction Particles
caspase 8 associated protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-5641s1c1
Sequence:CCGGGCCAGGATCAAATTGTGATAACTCGAGTTATCACAATTTGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2929s1c1
Sequence:CCGGGCCAATTTACAAATCTGACAACTCGAGTTGTCAGATTTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-520s1c1
Sequence:CCGGCCAGTCTCTTAAGAAGAATATCTCGAGATATTCTTCTTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-2834s1c1
Sequence:CCGGCCAGTGTATAATAACAGTCATCTCGAGATGACTGTTATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012115.2-4248s1c1
Sequence:CCGGGCGAGTCTATACCAGCTTGTACTCGAGTACAAGCTGGTATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-5331s21c1
Sequence:GTACCGGGATGTTCTGGAGGCAATTTAACTCGAGTTAAATTGCCTCCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-1978s21c1
Sequence:GTACCGGAGAGTCTTCAATGCAAGTTAACTCGAGTTAACTTGCATTGAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012115.2-6159s21c1
Sequence:CCGGTGGGACTCTTAACTGATATTGCTCGAGCAATATCAGTTAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012115.2-3536s21c1
Sequence:CCGGGGCATAGTTGATCGTTTATTTCTCGAGAAATAAACGATCAACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks