EMAIL THIS PAGE TO A FRIEND

CASP9

caspase 9, apoptosis-related cysteine peptidase

118 Gene Product Result for
Synonyms: APAF-3 APAF3 ICE-LAP6 MCH6 PPP1R56
Gene ID:
Human(842) Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein can undergo autoproteolytic processing and activation by the apoptosome, a protein complex of cytochrome c and the apoptotic peptidase activating factor 1; this step is thought to be one of the earliest in the caspase activation cascade. This protein is thought to play a central role in apoptosis and to be a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(12371) caspase 9
Rat(58918) caspase 9, apoptosis-related cysteine peptidase
Zebrafish(492763) caspase 9, apoptosis-related cysteine protease
dog(487432) caspase 9, apoptosis-related cysteine peptidase
Horse(100054331) caspase 9, apoptosis-related cysteine peptidase
cow(100140945) caspase 9, apoptosis-related cysteine peptidase
domestic cat(768260) caspase 9, apoptosis-related cysteine peptidase
chicken(426970) caspase 9, apoptosis-related cysteine peptidase
domestic guinea pig(100714954) caspase 9, apoptosis-related cysteine peptidase
naked mole-rat(101702898) caspase 9, apoptosis-related cysteine peptidase
sheep(101110953) caspase 9, apoptosis-related cysteine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503336 Anti-CASP9 (Cleaved-Asp315) antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4503337 Anti-CASP9 (Cleaved-Asp330), C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4502569 Anti-CASP9 (CLEAVED-ASP353), C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat
ELISA, immunohistochemistry, western blot pricing
HPA001473 Anti-CASP9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA046488 Anti-CASP9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503332 Anti-CASP9 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503333 Anti-CASP9 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4503334 Anti-CASP9 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503335 Anti-CASP9 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
C7729 Anti-Caspase 9 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
SAB4300683 Anti-Caspase 9 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB3500405 Anti-Caspase-9 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunoprecipitation, western blot pricing
SAB4504124 Anti-phospho-Caspase 9 (pSer144) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504125 Anti-phospho-Caspase 9 (pSer196) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4503807 Anti-phospho-Caspase 9 (pThr125) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301229 Anti-phospho-Caspase 9 (pThr125) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504123 Anti-phospho-Caspase 9 (pTyr153) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1305463 ANTI-PHOSPHO-CASPASE 9(S196) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0000842M1 Monoclonal Anti-CASP9 antibody produced in mouse clone 3B8-4G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403634 Monoclonal Anti-CASP9 antibody produced in mouse clone 4F12-G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
C4356 Monoclonal Anti-Caspase 9 antibody produced in mouse ~2 mg/mL, clone CAS9, purified immunoglobulin, buffered aqueous solution human
ELISA, microarray, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A5845 N-Acetyl-Leu-Glu-His-Asp-7-amido-4-trifluoromethylcoumarin ≥95% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001229 Rosetta Predictions human pricing
NM_032996 Rosetta Predictions human pricing
NM_031632 Rosetta Predictions rat pricing
NM_015733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141568 predicted 241
2 SASI_Hs01_00141569 predicted 1252
3 SASI_Hs01_00141570 predicted 1296
4 SASI_Hs01_00141571 predicted 1168
5 SASI_Hs01_00141572 predicted 1244
6 SASI_Hs01_00141573 predicted 1296
7 SASI_Hs02_00331396 predicted 1262
8 SASI_Hs01_00141574 predicted 1261
9 SASI_Hs01_00141575 predicted 1257
10 SASI_Hs01_00141576 predicted 1255
11 SASI_Hs01_00141577 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099782 predicted 246
2 SASI_Hs01_00099783 predicted 797
3 SASI_Hs01_00099784 predicted 844
4 SASI_Hs01_00099785 predicted 720
5 SASI_Hs01_00099786 predicted 790
6 SASI_Hs01_00099787 predicted 843
7 SASI_Hs02_00360636 predicted 806
8 SASI_Hs01_00099788 predicted 811
9 SASI_Hs01_00099789 predicted 798
10 SASI_Hs01_00099790 predicted 804
11 SASI_Hs01_00099791 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101063 predicted 594
2 SASI_Rn01_00101064 predicted 1030
3 SASI_Rn01_00101065 predicted 648
4 SASI_Rn01_00101066 predicted 1475
5 SASI_Rn01_00101067 predicted 219
6 SASI_Rn01_00101068 predicted 1326
7 SASI_Rn01_00101069 predicted 614
8 SASI_Rn01_00101070 predicted 392
9 SASI_Rn01_00101072 predicted 418
10 SASI_Rn02_00264938 predicted 919
11 SASI_Rn01_00101071 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187238 predicted 1115
2 SASI_Mm01_00187239 predicted 1754
3 SASI_Mm02_00323058 predicted 1370
4 SASI_Mm01_00187240 predicted 1670
5 SASI_Mm01_00187241 predicted 1820
6 SASI_Mm02_00323059 predicted 839
7 SASI_Mm01_00187244 predicted 807
8 SASI_Mm01_00187242 predicted 898
9 SASI_Mm01_00187245 predicted 501
10 SASI_Mm01_00187246 predicted 1511
11 SASI_Mm01_00187243 predicted 1222
12 SASI_Mm01_00187247 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001229
VALIDATED
CASP9 MISSION shRNA Bacterial Glycerol Stock
caspase 9, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1292s21c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001229.2-1500s21c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1118s21c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-306s21c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1118s1c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-306s1c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001229.x-578s1c1
Sequence:CCGGCCACTGCCTCATTATCAACAACTCGAGTTGTTGATAATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1292s1c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-1500s1c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001229
VALIDATED
CASP9 MISSION shRNA shRNA Plasmid DNA
caspase 9, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1292s21c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001229.2-1500s21c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1118s21c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-306s21c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1118s1c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-306s1c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001229.x-578s1c1
Sequence:CCGGCCACTGCCTCATTATCAACAACTCGAGTTGTTGATAATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1292s1c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-1500s1c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001229
VALIDATED
CASP9 MISSION shRNA Lentiviral Transduction Particles
caspase 9, apoptosis-related cysteine peptidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1292s21c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001229.2-1500s21c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-1118s21c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001229.2-306s21c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1118s1c1
Sequence:CCGGCTTTGTGTCCTACTCTACTTTCTCGAGAAAGTAGAGTAGGACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-306s1c1
Sequence:CCGGCCTTTGTTCATCTCCTGCTTACTCGAGTAAGCAGGAGATGAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001229.x-578s1c1
Sequence:CCGGCCACTGCCTCATTATCAACAACTCGAGTTGTTGATAATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001229.x-1292s1c1
Sequence:CCGGGATGCCTGGTTGCTTTAATTTCTCGAGAAATTAAAGCAACCAGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001229.x-1500s1c1
Sequence:CCGGCAGCTTCCAGATTGACGACAACTCGAGTTGTCGTCAATCTGGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015733
VALIDATED
CASP9 MISSION shRNA Bacterial Glycerol Stock
caspase 9, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-840s21c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015733.4-3105s21c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-711s21c1
Sequence:CCGGAGAGGTTCTCAGACCAGAAACCTCGAGGTTTCTGGTCTGAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-905s21c1
Sequence:CCGGCCAACTTGGACCGTGACAAACCTCGAGGTTTGTCACGGTCCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-352s21c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-3105s1c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-352s1c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-846s1c1
Sequence:CCGGCCTCATCATCAACAATGTGAACTCGAGTTCACATTGTTGATGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-840s1c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015733.3-1519s1c1
Sequence:CCGGGCCAATGCTGTTTCTGCGAAACTCGAGTTTCGCAGAAACAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015733
VALIDATED
CASP9 MISSION shRNA shRNA Plasmid DNA
caspase 9, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-840s21c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015733.4-3105s21c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-711s21c1
Sequence:CCGGAGAGGTTCTCAGACCAGAAACCTCGAGGTTTCTGGTCTGAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-905s21c1
Sequence:CCGGCCAACTTGGACCGTGACAAACCTCGAGGTTTGTCACGGTCCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-352s21c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-3105s1c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-352s1c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-846s1c1
Sequence:CCGGCCTCATCATCAACAATGTGAACTCGAGTTCACATTGTTGATGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-840s1c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015733.3-1519s1c1
Sequence:CCGGGCCAATGCTGTTTCTGCGAAACTCGAGTTTCGCAGAAACAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015733
VALIDATED
CASP9 MISSION shRNA Lentiviral Transduction Particles
caspase 9, apoptosis-related cysteine peptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-840s21c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015733.4-3105s21c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-711s21c1
Sequence:CCGGAGAGGTTCTCAGACCAGAAACCTCGAGGTTTCTGGTCTGAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-905s21c1
Sequence:CCGGCCAACTTGGACCGTGACAAACCTCGAGGTTTGTCACGGTCCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015733.4-352s21c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-3105s1c1
Sequence:CCGGGCCCGGAATCACCAATCATTACTCGAGTAATGATTGGTGATTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-352s1c1
Sequence:CCGGCGCGACATGATCGAGGATATTCTCGAGAATATCCTCGATCATGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-846s1c1
Sequence:CCGGCCTCATCATCAACAATGTGAACTCGAGTTCACATTGTTGATGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015733.3-840s1c1
Sequence:CCGGCCACTGCCTCATCATCAACAACTCGAGTTGTTGATGATGAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015733.3-1519s1c1
Sequence:CCGGGCCAATGCTGTTTCTGCGAAACTCGAGTTTCGCAGAAACAGCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks