EMAIL THIS PAGE TO A FRIEND

CASQ1

calsequestrin 1 (fast-twitch, skeletal muscle)

84 Gene Product Result for
Synonyms: CASQ PDIB1
UniProtKB ID: P31415, B1AKZ2, B2R863, Q8TBW7
Gene ID:
Human(844) Summary: This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
Mouse(12372) calsequestrin 1
Rat(686019) calsequestrin 1 (fast-twitch, skeletal muscle)
dog(608401) calsequestrin 1 (fast-twitch, skeletal muscle)
cow(508394) calsequestrin 1 (fast-twitch, skeletal muscle)
domestic cat(101091082) calsequestrin 1 (fast-twitch, skeletal muscle)
sheep(101118652) calsequestrin 1 (fast-twitch, skeletal muscle)
Domestic Rabbit(100009095) calsequestrin 1 (fast-twitch, skeletal muscle)
naked mole-rat(101720357) calsequestrin 1 (fast-twitch, skeletal muscle)
domestic guinea pig(100730063) calsequestrin 1 (fast-twitch, skeletal muscle)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0742 AQUA Peptide FFATFD[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001231 Rosetta Predictions human pricing
XM_001063867 Rosetta Predictions rat pricing
NM_009813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331401 predicted 949
2 SASI_Hs01_00150378 predicted 895
3 SASI_Hs01_00150379 predicted 527
4 SASI_Hs01_00150380 predicted 1454
5 SASI_Hs01_00150381 predicted 1432
6 SASI_Hs01_00150382 predicted 655
7 SASI_Hs01_00150385 predicted 321
8 SASI_Hs01_00150386 predicted 1117
9 SASI_Hs01_00150387 predicted 402
10 SASI_Hs02_00331402 predicted 729
11 SASI_Hs01_00150383 predicted 974
12 SASI_Hs01_00150384 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308529 predicted 927
2 SASI_Rn02_00308530 predicted 852
3 SASI_Rn02_00308531 predicted 550
4 SASI_Rn02_00308532 predicted 661
5 SASI_Rn02_00308533 predicted 600
6 SASI_Rn02_00308534 predicted 342
7 SASI_Rn02_00308535 predicted 1080
8 SASI_Rn02_00308536 predicted 480
9 SASI_Rn02_00308537 predicted 360
10 SASI_Rn02_00308538 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178399 predicted 880
2 SASI_Mm01_00178400 predicted 515
3 SASI_Mm01_00178401 predicted 931
4 SASI_Mm01_00178402 predicted 664
5 SASI_Mm01_00178403 predicted 870
6 SASI_Mm01_00178405 predicted 824
7 SASI_Mm01_00178406 predicted 757
8 SASI_Mm01_00178407 predicted 522
9 SASI_Mm01_00178408 predicted 323
10 SASI_Mm02_00317108 predicted 716
11 SASI_Mm01_00178404 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001231
CASQ1 MISSION shRNA Bacterial Glycerol Stock
calsequestrin 1 (fast-twitch, skeletal muscle)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1175s1c1
Sequence:CCGGCCCACAAATAGGAGTCGTCAACTCGAGTTGACGACTCCTATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1037s1c1
Sequence:CCGGCGAGTTCTTAGAGACTCTCAACTCGAGTTGAGAGTCTCTAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1207s1c1
Sequence:CCGGCGGATAGCGTATGGATGGAAACTCGAGTTTCCATCCATACGCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-302s1c1
Sequence:CCGGCAATGCAAAGAACTACAAGAACTCGAGTTCTTGTAGTTCTTTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-627s1c1
Sequence:CCGGGTGGAATTGATTGAAGGTGAACTCGAGTTCACCTTCAATCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-485s21c1
Sequence:CCGGGGATGACAAGGCCTCACAAAGCTCGAGCTTTGTGAGGCCTTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-781s21c1
Sequence:CCGGATATTGAGGATGAGATCAAACCTCGAGGTTTGATCTCATCCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-929s21c1
Sequence:CCGGGAAGCTGAATGAGATTGATTTCTCGAGAAATCAATCTCATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001231
CASQ1 MISSION shRNA shRNA Plasmid DNA
calsequestrin 1 (fast-twitch, skeletal muscle)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1175s1c1
Sequence:CCGGCCCACAAATAGGAGTCGTCAACTCGAGTTGACGACTCCTATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1037s1c1
Sequence:CCGGCGAGTTCTTAGAGACTCTCAACTCGAGTTGAGAGTCTCTAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1207s1c1
Sequence:CCGGCGGATAGCGTATGGATGGAAACTCGAGTTTCCATCCATACGCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-302s1c1
Sequence:CCGGCAATGCAAAGAACTACAAGAACTCGAGTTCTTGTAGTTCTTTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-627s1c1
Sequence:CCGGGTGGAATTGATTGAAGGTGAACTCGAGTTCACCTTCAATCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-485s21c1
Sequence:CCGGGGATGACAAGGCCTCACAAAGCTCGAGCTTTGTGAGGCCTTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-781s21c1
Sequence:CCGGATATTGAGGATGAGATCAAACCTCGAGGTTTGATCTCATCCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-929s21c1
Sequence:CCGGGAAGCTGAATGAGATTGATTTCTCGAGAAATCAATCTCATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001231
CASQ1 MISSION shRNA Lentiviral Transduction Particles
calsequestrin 1 (fast-twitch, skeletal muscle)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1175s1c1
Sequence:CCGGCCCACAAATAGGAGTCGTCAACTCGAGTTGACGACTCCTATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1037s1c1
Sequence:CCGGCGAGTTCTTAGAGACTCTCAACTCGAGTTGAGAGTCTCTAAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-1207s1c1
Sequence:CCGGCGGATAGCGTATGGATGGAAACTCGAGTTTCCATCCATACGCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-302s1c1
Sequence:CCGGCAATGCAAAGAACTACAAGAACTCGAGTTCTTGTAGTTCTTTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001231.2-627s1c1
Sequence:CCGGGTGGAATTGATTGAAGGTGAACTCGAGTTCACCTTCAATCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-485s21c1
Sequence:CCGGGGATGACAAGGCCTCACAAAGCTCGAGCTTTGTGAGGCCTTGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-781s21c1
Sequence:CCGGATATTGAGGATGAGATCAAACCTCGAGGTTTGATCTCATCCTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001231.4-929s21c1
Sequence:CCGGGAAGCTGAATGAGATTGATTTCTCGAGAAATCAATCTCATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009813
CASQ1 MISSION shRNA Bacterial Glycerol Stock
calsequestrin 1 (fast-twitch, skeletal muscle)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-326s1c1
Sequence:CCGGGAACTACAAGAACGTGTTTAACTCGAGTTAAACACGTTCTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-423s1c1
Sequence:CCGGGAGGAGCTAATCCTGGAGTTACTCGAGTAACTCCAGGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1107s1c1
Sequence:CCGGCTCAGTATCATCTGGATTGATCTCGAGATCAATCCAGATGATACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1194s1c1
Sequence:CCGGCAAATAGGAGTTGTCAATGTTCTCGAGAACATTGACAACTCCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-669s1c1
Sequence:CCGGCTGCAGGCATTTGAGAATATTCTCGAGAATATTCTCAAATGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009813.2-1050s21c1
Sequence:CCGGGAATCCACATTGTCGCCTTTGCTCGAGCAAAGGCGACAATGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009813.2-1464s21c1
Sequence:CCGGCTCCTTACTTGTTGTACCTTTCTCGAGAAAGGTACAACAAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009813
CASQ1 MISSION shRNA shRNA Plasmid DNA
calsequestrin 1 (fast-twitch, skeletal muscle)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-326s1c1
Sequence:CCGGGAACTACAAGAACGTGTTTAACTCGAGTTAAACACGTTCTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-423s1c1
Sequence:CCGGGAGGAGCTAATCCTGGAGTTACTCGAGTAACTCCAGGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1107s1c1
Sequence:CCGGCTCAGTATCATCTGGATTGATCTCGAGATCAATCCAGATGATACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1194s1c1
Sequence:CCGGCAAATAGGAGTTGTCAATGTTCTCGAGAACATTGACAACTCCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-669s1c1
Sequence:CCGGCTGCAGGCATTTGAGAATATTCTCGAGAATATTCTCAAATGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009813.2-1050s21c1
Sequence:CCGGGAATCCACATTGTCGCCTTTGCTCGAGCAAAGGCGACAATGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009813.2-1464s21c1
Sequence:CCGGCTCCTTACTTGTTGTACCTTTCTCGAGAAAGGTACAACAAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009813
CASQ1 MISSION shRNA Lentiviral Transduction Particles
calsequestrin 1 (fast-twitch, skeletal muscle)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-326s1c1
Sequence:CCGGGAACTACAAGAACGTGTTTAACTCGAGTTAAACACGTTCTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-423s1c1
Sequence:CCGGGAGGAGCTAATCCTGGAGTTACTCGAGTAACTCCAGGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1107s1c1
Sequence:CCGGCTCAGTATCATCTGGATTGATCTCGAGATCAATCCAGATGATACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-1194s1c1
Sequence:CCGGCAAATAGGAGTTGTCAATGTTCTCGAGAACATTGACAACTCCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009813.1-669s1c1
Sequence:CCGGCTGCAGGCATTTGAGAATATTCTCGAGAATATTCTCAAATGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009813.2-1050s21c1
Sequence:CCGGGAATCCACATTGTCGCCTTTGCTCGAGCAAAGGCGACAATGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009813.2-1464s21c1
Sequence:CCGGCTCCTTACTTGTTGTACCTTTCTCGAGAAAGGTACAACAAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks