EMAIL THIS PAGE TO A FRIEND

CASQ2

calsequestrin 2 (cardiac muscle)

96 Gene Product Result for
Synonyms: PDIB2
UniProtKB ID: O14958, B2R7M6, Q5T1D2, Q8TBW8
Gene ID:
Human(845) Summary: The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
Mouse(12373) calsequestrin 2
Rat(29209) calsequestrin 2 (cardiac muscle)
Zebrafish(114410) calsequestrin 2
chicken(395198) calsequestrin 2 (cardiac muscle)
dog(483134) calsequestrin 2 (cardiac muscle)
domestic cat(101082678) calsequestrin 2 (cardiac muscle)
cow(528555) calsequestrin 2 (cardiac muscle)
domestic guinea pig(100722777) calsequestrin 2 (cardiac muscle)
naked mole-rat(101723728) calsequestrin 2 (cardiac muscle)
sheep(101105292) calsequestrin 2 (cardiac muscle)
Domestic Rabbit(100009261) calsequestrin 2 (cardiac muscle)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0742 AQUA Peptide FFATFD[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001232 Rosetta Predictions human pricing
NM_017131 Rosetta Predictions rat pricing
NM_009814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099752 predicted 365
2 SASI_Hs01_00099754 predicted 787
3 SASI_Hs01_00099755 predicted 602
4 SASI_Hs01_00099756 predicted 354
5 SASI_Hs02_00331403 predicted 939
6 SASI_Hs01_00099757 predicted 633
7 SASI_Hs01_00099758 predicted 650
8 SASI_Hs01_00099759 predicted 979
9 SASI_Hs02_00331404 predicted 265
10 SASI_Hs01_00099760 predicted 713
11 SASI_Hs01_00099753 predicted 290
12 SASI_Hs01_00099761 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065420 predicted 298
2 SASI_Rn01_00065421 predicted 618
3 SASI_Rn01_00065422 predicted 794
4 SASI_Rn01_00065423 predicted 800
5 SASI_Rn01_00065424 predicted 413
6 SASI_Rn01_00065425 predicted 293
7 SASI_Rn02_00261371 predicted 341
8 SASI_Rn01_00065427 predicted 687
9 SASI_Rn01_00065428 predicted 728
10 SASI_Rn01_00065429 predicted 286
11 SASI_Rn01_00065426 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185895 predicted 730
2 SASI_Mm02_00317109 predicted 268
3 SASI_Mm01_00185902 predicted 685
4 SASI_Mm02_00317110 predicted 270
5 SASI_Mm02_00317111 predicted 705
6 SASI_Mm02_00317112 predicted 516
7 SASI_Mm01_00185903 predicted 597
8 SASI_Mm02_00317113 predicted 782
9 SASI_Mm01_00185900 predicted 653
10 SASI_Mm01_00185904 predicted 914
11 SASI_Mm01_00185896 predicted 1495
12 SASI_Mm01_00185897 predicted 275
13 SASI_Mm01_00185898 predicted 1467
14 SASI_Mm01_00185899 predicted 1481
15 SASI_Mm01_00185901 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001232
CASQ2 MISSION shRNA Bacterial Glycerol Stock
calsequestrin 2 (cardiac muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-504s21c1
Sequence:CCGGGGCCCAGGTCCTTGAACATAACTCGAGTTATGTTCAAGGACCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-671s21c1
Sequence:CCGGAGTTCCTCTTGGATCTAATTGCTCGAGCAATTAGATCCAAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-1069s1c1
Sequence:CCGGGACTTTCAAGATTGACCTATTCTCGAGAATAGGTCAATCTTGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-866s1c1
Sequence:CCGGCGCCCAGAAGAAATGTTTGAACTCGAGTTCAAACATTTCTTCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-676s1c1
Sequence:CCGGCCAGCCTTACATCAAATTCTTCTCGAGAAGAATTTGATGTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-593s1c1
Sequence:CCGGGAAGACTACATCAAACTCATTCTCGAGAATGAGTTTGATGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-412s1c1
Sequence:CCGGGCTTGCCAAGAAACTGGGTTTCTCGAGAAACCCAGTTTCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001232
CASQ2 MISSION shRNA shRNA Plasmid DNA
calsequestrin 2 (cardiac muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-504s21c1
Sequence:CCGGGGCCCAGGTCCTTGAACATAACTCGAGTTATGTTCAAGGACCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-671s21c1
Sequence:CCGGAGTTCCTCTTGGATCTAATTGCTCGAGCAATTAGATCCAAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-1069s1c1
Sequence:CCGGGACTTTCAAGATTGACCTATTCTCGAGAATAGGTCAATCTTGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-866s1c1
Sequence:CCGGCGCCCAGAAGAAATGTTTGAACTCGAGTTCAAACATTTCTTCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-676s1c1
Sequence:CCGGCCAGCCTTACATCAAATTCTTCTCGAGAAGAATTTGATGTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-593s1c1
Sequence:CCGGGAAGACTACATCAAACTCATTCTCGAGAATGAGTTTGATGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-412s1c1
Sequence:CCGGGCTTGCCAAGAAACTGGGTTTCTCGAGAAACCCAGTTTCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001232
CASQ2 MISSION shRNA Lentiviral Transduction Particles
calsequestrin 2 (cardiac muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-504s21c1
Sequence:CCGGGGCCCAGGTCCTTGAACATAACTCGAGTTATGTTCAAGGACCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001232.3-671s21c1
Sequence:CCGGAGTTCCTCTTGGATCTAATTGCTCGAGCAATTAGATCCAAGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-1069s1c1
Sequence:CCGGGACTTTCAAGATTGACCTATTCTCGAGAATAGGTCAATCTTGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-866s1c1
Sequence:CCGGCGCCCAGAAGAAATGTTTGAACTCGAGTTCAAACATTTCTTCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-676s1c1
Sequence:CCGGCCAGCCTTACATCAAATTCTTCTCGAGAAGAATTTGATGTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-593s1c1
Sequence:CCGGGAAGACTACATCAAACTCATTCTCGAGAATGAGTTTGATGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001232.1-412s1c1
Sequence:CCGGGCTTGCCAAGAAACTGGGTTTCTCGAGAAACCCAGTTTCTTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009814
CASQ2 MISSION shRNA Bacterial Glycerol Stock
calsequestrin 2 (cardiac muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009814.1-1508s1c1
Sequence:CCGGCCCTTGTTCTTTGCTAGACAACTCGAGTTGTCTAGCAAAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-111s1c1
Sequence:CCGGCCTATCTGAGAAGAACCTCAACTCGAGTTGAGGTTCTTCTCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-1082s1c1
Sequence:CCGGACTGGATTGAAGATGTGCTTTCTCGAGAAAGCACATCTTCAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-435s1c1
Sequence:CCGGCCCAGTGGAGATCGTGAATAACTCGAGTTATTCACGATCTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-673s1c1
Sequence:CCGGCCCAACGTCATCCCTAACAAACTCGAGTTTGTTAGGGATGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009814
CASQ2 MISSION shRNA shRNA Plasmid DNA
calsequestrin 2 (cardiac muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009814.1-1508s1c1
Sequence:CCGGCCCTTGTTCTTTGCTAGACAACTCGAGTTGTCTAGCAAAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-111s1c1
Sequence:CCGGCCTATCTGAGAAGAACCTCAACTCGAGTTGAGGTTCTTCTCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-1082s1c1
Sequence:CCGGACTGGATTGAAGATGTGCTTTCTCGAGAAAGCACATCTTCAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-435s1c1
Sequence:CCGGCCCAGTGGAGATCGTGAATAACTCGAGTTATTCACGATCTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-673s1c1
Sequence:CCGGCCCAACGTCATCCCTAACAAACTCGAGTTTGTTAGGGATGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009814
CASQ2 MISSION shRNA Lentiviral Transduction Particles
calsequestrin 2 (cardiac muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009814.1-1508s1c1
Sequence:CCGGCCCTTGTTCTTTGCTAGACAACTCGAGTTGTCTAGCAAAGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-111s1c1
Sequence:CCGGCCTATCTGAGAAGAACCTCAACTCGAGTTGAGGTTCTTCTCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-1082s1c1
Sequence:CCGGACTGGATTGAAGATGTGCTTTCTCGAGAAAGCACATCTTCAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-435s1c1
Sequence:CCGGCCCAGTGGAGATCGTGAATAACTCGAGTTATTCACGATCTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009814.1-673s1c1
Sequence:CCGGCCCAACGTCATCCCTAACAAACTCGAGTTTGTTAGGGATGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks