EMAIL THIS PAGE TO A FRIEND

CASR

calcium-sensing receptor

148 Gene Product Result for
Synonyms: CAR EIG8 FHH FIH GPRC2A HHC HHC1 HYPOC1 NSHPT PCAR1
Gene ID:
Human(846) Summary: The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
Mouse(12374) calcium-sensing receptor
Rat(24247) calcium-sensing receptor
sheep(101112527) calcium-sensing receptor
naked mole-rat(101725174) calcium-sensing receptor
domestic guinea pig(100718111) calcium-sensing receptor
chicken(418266) calcium-sensing receptor
domestic cat(100302732) calcium-sensing receptor
Horse(100034084) calcium-sensing receptor
cow(281038) calcium-sensing receptor
dog(488007) calcium-sensing receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503369 Anti-Calcium Sensing Receptor antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
C4491 Anti-Calcium-Sensing Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1405561 Anti-CASR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA050335 Anti-CASR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA039686 Anti-CASR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4504119 Anti-phospho-Calcium Sensing Receptor (pThr888) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4301537 Anti-phospho-Calcium Sensing Receptor (pThr888) antibody produced in rabbit affinity isolated antibody human
western blot pricing
C0493 Monoclonal Anti-Calcium Sensing Receptor antibody produced in mouse clone HL1499 (6D4-3F4-6C4), purified from hybridoma cell culture rabbit, human, mouse, rat
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
WH0000846M1 Monoclonal Anti-CASR antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087081 MISSION® esiRNA esiRNA human CASR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000388 Rosetta Predictions human pricing
NM_016996 Rosetta Predictions rat pricing
NM_013803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038398 predicted 501
2 SASI_Hs01_00038399 predicted 1088
3 SASI_Hs01_00038400 predicted 893
4 SASI_Hs01_00038402 predicted 652
5 SASI_Hs01_00038403 predicted 1208
6 SASI_Hs01_00038404 predicted 1924
7 SASI_Hs02_00302457 predicted 632
8 SASI_Hs01_00038406 predicted 1874
9 SASI_Hs01_00038407 predicted 664
10 SASI_Hs02_00302458 predicted 2853
11 SASI_Hs01_00038401 predicted 2569
12 SASI_Hs01_00038405 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080449 predicted 1811
2 SASI_Rn01_00080450 predicted 1095
3 SASI_Rn01_00080451 predicted 3055
4 SASI_Rn01_00080452 predicted 935
5 SASI_Rn01_00080453 predicted 3144
6 SASI_Rn01_00080454 predicted 1407
7 SASI_Rn02_00261139 predicted 1486
8 SASI_Rn01_00080455 predicted 788
9 SASI_Rn01_00080456 predicted 780
10 SASI_Rn01_00080457 predicted 2122
11 SASI_Rn01_00080458 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121061 predicted 1754
2 SASI_Mm01_00121056 predicted 1619
3 SASI_Mm01_00121057 predicted 3095
4 SASI_Mm02_00322763 predicted 2304
5 SASI_Mm01_00121058 predicted 3398
6 SASI_Mm01_00121059 predicted 1764
7 SASI_Mm02_00322764 predicted 2587
8 SASI_Mm01_00121060 predicted 1357
9 SASI_Mm02_00322765 predicted 2024
10 SASI_Mm01_00121064 predicted 731
11 SASI_Mm01_00121062 predicted 2439
12 SASI_Mm01_00121063 predicted 795
13 SASI_Mm01_00121065 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000388
CASR MISSION shRNA Bacterial Glycerol Stock
calcium-sensing receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000388.2-4598s1c1
Sequence:CCGGCCAAGAAAGATCCACCCTCAACTCGAGTTGAGGGTGGATCTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-577s1c1
Sequence:CCGGCGCTGGTTACAGGCTATGATACTCGAGTATCATAGCCTGTAACCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-1591s1c1
Sequence:CCGGCCTTACATAGATTACACGCATCTCGAGATGCGTGTAATCTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-2128s1c1
Sequence:CCGGCCAGATGACTTCTGGTCCAATCTCGAGATTGGACCAGAAGTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1868s21c1
Sequence:CCGGAGGATGGCTCCATCGTGTTTACTCGAGTAAACACGATGGAGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1895s21c1
Sequence:CCGGTCGGGTATTACAACGTCTATGCTCGAGCATAGACGTTGTAATACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-578s21c1
Sequence:CCGGGCTGGTTACAGGCTATGATATCTCGAGATATCATAGCCTGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-544s21c1
Sequence:CCGGGTGGAATGTATCAGGTATAATCTCGAGATTATACCTGATACATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000388
CASR MISSION shRNA shRNA Plasmid DNA
calcium-sensing receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000388.2-4598s1c1
Sequence:CCGGCCAAGAAAGATCCACCCTCAACTCGAGTTGAGGGTGGATCTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-577s1c1
Sequence:CCGGCGCTGGTTACAGGCTATGATACTCGAGTATCATAGCCTGTAACCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-1591s1c1
Sequence:CCGGCCTTACATAGATTACACGCATCTCGAGATGCGTGTAATCTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-2128s1c1
Sequence:CCGGCCAGATGACTTCTGGTCCAATCTCGAGATTGGACCAGAAGTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1868s21c1
Sequence:CCGGAGGATGGCTCCATCGTGTTTACTCGAGTAAACACGATGGAGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1895s21c1
Sequence:CCGGTCGGGTATTACAACGTCTATGCTCGAGCATAGACGTTGTAATACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-578s21c1
Sequence:CCGGGCTGGTTACAGGCTATGATATCTCGAGATATCATAGCCTGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-544s21c1
Sequence:CCGGGTGGAATGTATCAGGTATAATCTCGAGATTATACCTGATACATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000388
CASR MISSION shRNA Lentiviral Transduction Particles
calcium-sensing receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000388.2-4598s1c1
Sequence:CCGGCCAAGAAAGATCCACCCTCAACTCGAGTTGAGGGTGGATCTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-577s1c1
Sequence:CCGGCGCTGGTTACAGGCTATGATACTCGAGTATCATAGCCTGTAACCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-1591s1c1
Sequence:CCGGCCTTACATAGATTACACGCATCTCGAGATGCGTGTAATCTATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000388.2-2128s1c1
Sequence:CCGGCCAGATGACTTCTGGTCCAATCTCGAGATTGGACCAGAAGTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1868s21c1
Sequence:CCGGAGGATGGCTCCATCGTGTTTACTCGAGTAAACACGATGGAGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-1895s21c1
Sequence:CCGGTCGGGTATTACAACGTCTATGCTCGAGCATAGACGTTGTAATACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-578s21c1
Sequence:CCGGGCTGGTTACAGGCTATGATATCTCGAGATATCATAGCCTGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000388.3-544s21c1
Sequence:CCGGGTGGAATGTATCAGGTATAATCTCGAGATTATACCTGATACATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013803
CASR MISSION shRNA Bacterial Glycerol Stock
calcium-sensing receptor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1753s1c1
Sequence:CCGGGCTACGAACATTTACGGATATCTCGAGATATCCGTAAATGTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1919s1c1
Sequence:CCGGGCACCTGAATTTCACCAACAACTCGAGTTGTTGGTGAAATTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-3527s1c1
Sequence:CCGGCCAGAAGAGCAATGACACTTTCTCGAGAAAGTGTCATTGCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-790s1c1
Sequence:CCGGCCAACATGACTCTGGGATATACTCGAGTATATCCCAGAGTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013803
CASR MISSION shRNA shRNA Plasmid DNA
calcium-sensing receptor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1753s1c1
Sequence:CCGGGCTACGAACATTTACGGATATCTCGAGATATCCGTAAATGTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1919s1c1
Sequence:CCGGGCACCTGAATTTCACCAACAACTCGAGTTGTTGGTGAAATTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-3527s1c1
Sequence:CCGGCCAGAAGAGCAATGACACTTTCTCGAGAAAGTGTCATTGCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-790s1c1
Sequence:CCGGCCAACATGACTCTGGGATATACTCGAGTATATCCCAGAGTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013803
CASR MISSION shRNA Lentiviral Transduction Particles
calcium-sensing receptor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1753s1c1
Sequence:CCGGGCTACGAACATTTACGGATATCTCGAGATATCCGTAAATGTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-1919s1c1
Sequence:CCGGGCACCTGAATTTCACCAACAACTCGAGTTGTTGGTGAAATTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-3527s1c1
Sequence:CCGGCCAGAAGAGCAATGACACTTTCTCGAGAAAGTGTCATTGCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013803.1-790s1c1
Sequence:CCGGCCAACATGACTCTGGGATATACTCGAGTATATCCCAGAGTCATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks