EMAIL THIS PAGE TO A FRIEND

CASS4

Cas scaffolding protein family member 4

68 Gene Product Result for
Synonyms: C20orf32 CAS4 HEFL HEPL
UniProtKB ID: Q9NQ75, E1P5Z8, Q5QPD6, Q96K09, Q9BYL5
Gene ID:
Mouse(320664) Cas scaffolding protein family member 4
Rat(296409) Cas scaffolding protein family member 4
chicken(419330) Cas scaffolding protein family member 4
dog(477269) Cas scaffolding protein family member 4
domestic cat(101094917) Cas scaffolding protein family member 4
cow(512832) Cas scaffolding protein family member 4
Horse(100054698) Cas scaffolding protein family member 4
domestic guinea pig(100720400) Cas scaffolding protein family member 4
naked mole-rat(101711096) Cas scaffolding protein family member 4
sheep(101105178) Cas scaffolding protein family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020356 Rosetta Predictions human pricing
XM_001053920 Rosetta Predictions rat pricing
XM_230891 Rosetta Predictions rat pricing
NM_001033538 Rosetta Predictions mouse pricing
NM_001080820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050520 predicted 1100
2 SASI_Hs01_00050521 predicted 1337
3 SASI_Hs01_00050522 predicted 1600
4 SASI_Hs01_00050523 predicted 2249
5 SASI_Hs01_00050524 predicted 831
6 SASI_Hs01_00050526 predicted 854
7 SASI_Hs01_00050527 predicted 875
8 SASI_Hs01_00050528 predicted 1748
9 SASI_Hs01_00050529 predicted 1814
10 SASI_Hs02_00353292 predicted 1137
11 SASI_Hs01_00050525 predicted 1767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274038 predicted 951
2 SASI_Rn02_00274039 predicted 943
3 SASI_Rn02_00274040 predicted 1638
4 SASI_Rn02_00274041 predicted 2222
5 SASI_Rn02_00274042 predicted 873
6 SASI_Rn02_00274043 predicted 1724
7 SASI_Rn02_00274044 predicted 824
8 SASI_Rn02_00274045 predicted 2185
9 SASI_Rn02_00274046 predicted 865
10 SASI_Rn02_00274047 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386552 predicted 951
2 SASI_Rn02_00386553 predicted 934
3 SASI_Rn02_00386554 predicted 1639
4 SASI_Rn02_00386555 predicted 2222
5 SASI_Rn02_00386556 predicted 873
6 SASI_Rn02_00386557 predicted 1730
7 SASI_Rn02_00386558 predicted 820
8 SASI_Rn02_00386559 predicted 2191
9 SASI_Rn02_00386560 predicted 866
10 SASI_Rn02_00386561 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288905 predicted 861
2 SASI_Mm02_00288906 predicted 1628
3 SASI_Mm02_00288907 predicted 1724
4 SASI_Mm02_00288908 predicted 939
5 SASI_Mm02_00288909 predicted 1692
6 SASI_Mm01_00176261 predicted 817
7 SASI_Mm01_00176262 predicted 875
8 SASI_Mm01_00176263 predicted 960
9 SASI_Mm02_00288910 predicted 841
10 SASI_Mm01_00176267 predicted 1780
11 SASI_Mm01_00176259 predicted 1964
12 SASI_Mm01_00176260 predicted 2081
13 SASI_Mm01_00176264 predicted 2236
14 SASI_Mm01_00176265 predicted 1889
15 SASI_Mm01_00176266 predicted 838
16 SASI_Mm01_00176268 predicted 2145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293933 predicted 757
2 SASI_Mm02_00293934 predicted 1520
3 SASI_Mm02_00293935 predicted 1621
4 SASI_Mm02_00293936 predicted 835
5 SASI_Mm02_00293937 predicted 1588
6 SASI_Mm02_00293938 predicted 706
7 SASI_Mm02_00293939 predicted 773
8 SASI_Mm02_00293940 predicted 853
9 SASI_Mm02_00293941 predicted 738
10 SASI_Mm02_00293942 predicted 1674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020356
CASS4 MISSION shRNA Bacterial Glycerol Stock
Cas scaffolding protein family member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020356.3-883s21c1
Sequence:CCGGAGAGGCGGTTACAGCACATTACTCGAGTAATGTGCTGTAACCGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020356.3-2756s21c1
Sequence:CCGGAGAGTCAGGTATGAGGTAAAGCTCGAGCTTTACCTCATACCTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-272s1c1
Sequence:CCGGCCAGGGCACTTTATGACAACTCTCGAGAGTTGTCATAAAGTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1672s1c1
Sequence:CCGGGATCACATAGAAGCCTCTGTACTCGAGTACAGAGGCTTCTATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1140s1c1
Sequence:CCGGCCTTCCAGAAATTCCTTCTTACTCGAGTAAGAAGGAATTTCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-2125s1c1
Sequence:CCGGGAACACTCTTCTGAACTATTACTCGAGTAATAGTTCAGAAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1614s1c1
Sequence:CCGGGAAGTGGAGATTCCGAGACTACTCGAGTAGTCTCGGAATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1251s1c1
Sequence:CCGGGCAGAACACCAAGCCCAATATCTCGAGATATTGGGCTTGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1930s1c1
Sequence:CCGGCCAGAAGACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020356
CASS4 MISSION shRNA shRNA Plasmid DNA
Cas scaffolding protein family member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020356.3-883s21c1
Sequence:CCGGAGAGGCGGTTACAGCACATTACTCGAGTAATGTGCTGTAACCGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020356.3-2756s21c1
Sequence:CCGGAGAGTCAGGTATGAGGTAAAGCTCGAGCTTTACCTCATACCTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-272s1c1
Sequence:CCGGCCAGGGCACTTTATGACAACTCTCGAGAGTTGTCATAAAGTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1672s1c1
Sequence:CCGGGATCACATAGAAGCCTCTGTACTCGAGTACAGAGGCTTCTATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1140s1c1
Sequence:CCGGCCTTCCAGAAATTCCTTCTTACTCGAGTAAGAAGGAATTTCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-2125s1c1
Sequence:CCGGGAACACTCTTCTGAACTATTACTCGAGTAATAGTTCAGAAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1614s1c1
Sequence:CCGGGAAGTGGAGATTCCGAGACTACTCGAGTAGTCTCGGAATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1251s1c1
Sequence:CCGGGCAGAACACCAAGCCCAATATCTCGAGATATTGGGCTTGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1930s1c1
Sequence:CCGGCCAGAAGACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020356
CASS4 MISSION shRNA Lentiviral Transduction Particles
Cas scaffolding protein family member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020356.3-883s21c1
Sequence:CCGGAGAGGCGGTTACAGCACATTACTCGAGTAATGTGCTGTAACCGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020356.3-2756s21c1
Sequence:CCGGAGAGTCAGGTATGAGGTAAAGCTCGAGCTTTACCTCATACCTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-272s1c1
Sequence:CCGGCCAGGGCACTTTATGACAACTCTCGAGAGTTGTCATAAAGTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1672s1c1
Sequence:CCGGGATCACATAGAAGCCTCTGTACTCGAGTACAGAGGCTTCTATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1140s1c1
Sequence:CCGGCCTTCCAGAAATTCCTTCTTACTCGAGTAAGAAGGAATTTCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020356.1-2125s1c1
Sequence:CCGGGAACACTCTTCTGAACTATTACTCGAGTAATAGTTCAGAAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1614s1c1
Sequence:CCGGGAAGTGGAGATTCCGAGACTACTCGAGTAGTCTCGGAATCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1251s1c1
Sequence:CCGGGCAGAACACCAAGCCCAATATCTCGAGATATTGGGCTTGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020356.1-1930s1c1
Sequence:CCGGCCAGAAGACATCAAGAGGTTTCTCGAGAAACCTCTTGATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033538
CASS4 MISSION shRNA Bacterial Glycerol Stock
Cas scaffolding protein family member 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1699s1c1
Sequence:CCGGGCTACCTTCAGGCTAGAATTACTCGAGTAATTCTAGCCTGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033538.1-2967s1c1
Sequence:CCGGGCTGTCTTATAGAACTTAGTACTCGAGTACTAAGTTCTATAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-931s1c1
Sequence:CCGGCCGATGTCAGAAATGTGTCTACTCGAGTAGACACATTTCTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1892s1c1
Sequence:CCGGGAGGTTTACCTCCATCGTCATCTCGAGATGACGATGGAGGTAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1803s1c1
Sequence:CCGGGAAGTTCTTGTGACAGACAAACTCGAGTTTGTCTGTCACAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-882s1c1
Sequence:CCGGCCTCAGAAGTCAGAACGGATTCTCGAGAATCCGTTCTGACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1730s1c1
Sequence:CCGGCCAGACAATCTCTAGCTCCTACTCGAGTAGGAGCTAGAGATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1620s1c1
Sequence:CCGGGACCACGTAGAGGAATCTGTACTCGAGTACAGATTCCTCTACGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033538
CASS4 MISSION shRNA shRNA Plasmid DNA
Cas scaffolding protein family member 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1699s1c1
Sequence:CCGGGCTACCTTCAGGCTAGAATTACTCGAGTAATTCTAGCCTGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033538.1-2967s1c1
Sequence:CCGGGCTGTCTTATAGAACTTAGTACTCGAGTACTAAGTTCTATAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-931s1c1
Sequence:CCGGCCGATGTCAGAAATGTGTCTACTCGAGTAGACACATTTCTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1892s1c1
Sequence:CCGGGAGGTTTACCTCCATCGTCATCTCGAGATGACGATGGAGGTAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1803s1c1
Sequence:CCGGGAAGTTCTTGTGACAGACAAACTCGAGTTTGTCTGTCACAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-882s1c1
Sequence:CCGGCCTCAGAAGTCAGAACGGATTCTCGAGAATCCGTTCTGACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1730s1c1
Sequence:CCGGCCAGACAATCTCTAGCTCCTACTCGAGTAGGAGCTAGAGATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1620s1c1
Sequence:CCGGGACCACGTAGAGGAATCTGTACTCGAGTACAGATTCCTCTACGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033538
CASS4 MISSION shRNA Lentiviral Transduction Particles
Cas scaffolding protein family member 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1699s1c1
Sequence:CCGGGCTACCTTCAGGCTAGAATTACTCGAGTAATTCTAGCCTGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033538.1-2967s1c1
Sequence:CCGGGCTGTCTTATAGAACTTAGTACTCGAGTACTAAGTTCTATAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-931s1c1
Sequence:CCGGCCGATGTCAGAAATGTGTCTACTCGAGTAGACACATTTCTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1892s1c1
Sequence:CCGGGAGGTTTACCTCCATCGTCATCTCGAGATGACGATGGAGGTAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1803s1c1
Sequence:CCGGGAAGTTCTTGTGACAGACAAACTCGAGTTTGTCTGTCACAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-882s1c1
Sequence:CCGGCCTCAGAAGTCAGAACGGATTCTCGAGAATCCGTTCTGACTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033538.1-1730s1c1
Sequence:CCGGCCAGACAATCTCTAGCTCCTACTCGAGTAGGAGCTAGAGATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033538.1-1620s1c1
Sequence:CCGGGACCACGTAGAGGAATCTGTACTCGAGTACAGATTCCTCTACGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks