EMAIL THIS PAGE TO A FRIEND

CAST

calpastatin

197 Gene Product Result for
Synonyms: BS-17
Gene ID:
Human(831) Summary: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
Mouse(12380) calpastatin
Rat(25403) calpastatin
Goat(100861304) calpastatin
sheep(443364) calpastatin
Zebrafish(563084) calpastatin
fruit fly(247972) ojos castanos
cow(281039) calpastatin
Horse(100073225) calpastatin
dog(479148) calpastatin
chicken(427121) calpastatin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW20006A Anti-Calpastatin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB5500027 Anti-Calpastatin antibody, Rabbit monoclonal clone SP82, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
C8238 Anti-Calpastatin, N-Terminal (Domain-L) Testis Isoform antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1405558 Anti-CAST antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA036881 Anti-CAST antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA036882 Anti-CAST antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
C270 Monoclonal Anti-Calpastatin antibody produced in mouse clone 1F7E3D10, ascites fluid, buffered aqueous solution pig, rat, bovine, human
immunofluorescence, western blot pricing
SAB4100450 Monoclonal Anti-CAST antibody produced in mouse clone CAST-A387, culture supernatant human
western blot pricing
SAB1402139 Monoclonal Anti-CAST antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042440 Rosetta Predictions human pricing
NM_001042441 Rosetta Predictions human pricing
NM_001042442 Rosetta Predictions human pricing
NM_001042443 Rosetta Predictions human pricing
NM_001042444 Rosetta Predictions human pricing
NM_001042445 Rosetta Predictions human pricing
NM_001042446 Rosetta Predictions human pricing
NM_001750 Rosetta Predictions human pricing
NM_173060 Rosetta Predictions human pricing
NM_173061 Rosetta Predictions human pricing
NM_173062 Rosetta Predictions human pricing
NM_173063 Rosetta Predictions human pricing
NM_001033715 Rosetta Predictions rat pricing
NM_001033716 Rosetta Predictions rat pricing
NM_053295 Rosetta Predictions rat pricing
NM_009817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309778 predicted 2316
2 SASI_Hs02_00309779 predicted 2319
3 SASI_Hs02_00309780 predicted 2192
4 SASI_Hs02_00309781 predicted 2201
5 SASI_Hs02_00309782 predicted 1660
6 SASI_Hs02_00309783 predicted 1592
7 SASI_Hs02_00309784 predicted 1740
8 SASI_Hs02_00309785 predicted 1647
9 SASI_Hs02_00309786 predicted 1662
10 SASI_Hs02_00309787 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309788 predicted 2381
2 SASI_Hs02_00309789 predicted 2389
3 SASI_Hs02_00309790 predicted 2265
4 SASI_Hs02_00309791 predicted 2273
5 SASI_Hs02_00309792 predicted 1733
6 SASI_Hs02_00309793 predicted 1655
7 SASI_Hs02_00309794 predicted 1802
8 SASI_Hs02_00309795 predicted 1710
9 SASI_Hs02_00309796 predicted 1726
10 SASI_Hs02_00309797 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309798 predicted 2370
2 SASI_Hs02_00309799 predicted 2376
3 SASI_Hs02_00309800 predicted 2250
4 SASI_Hs02_00309801 predicted 2258
5 SASI_Hs02_00309802 predicted 1721
6 SASI_Hs02_00309803 predicted 1647
7 SASI_Hs02_00309804 predicted 1796
8 SASI_Hs02_00309805 predicted 1696
9 SASI_Hs02_00309806 predicted 1717
10 SASI_Hs02_00309807 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309808 predicted 2167
2 SASI_Hs02_00309809 predicted 2168
3 SASI_Hs02_00309810 predicted 2042
4 SASI_Hs02_00309811 predicted 2056
5 SASI_Hs02_00309812 predicted 1511
6 SASI_Hs02_00309813 predicted 1441
7 SASI_Hs02_00309814 predicted 1590
8 SASI_Hs02_00309815 predicted 1492
9 SASI_Hs02_00309816 predicted 1513
10 SASI_Hs02_00309817 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309818 predicted 2044
2 SASI_Hs02_00309819 predicted 2042
3 SASI_Hs02_00309820 predicted 1926
4 SASI_Hs02_00309821 predicted 1929
5 SASI_Hs02_00309822 predicted 1390
6 SASI_Hs02_00309823 predicted 1317
7 SASI_Hs02_00309824 predicted 1467
8 SASI_Hs02_00309825 predicted 1368
9 SASI_Hs02_00309826 predicted 1393
10 SASI_Hs02_00309827 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309828 predicted 2053
2 SASI_Hs02_00309829 predicted 2064
3 SASI_Hs02_00309830 predicted 1942
4 SASI_Hs02_00309831 predicted 1952
5 SASI_Hs02_00309832 predicted 1408
6 SASI_Hs02_00309833 predicted 1331
7 SASI_Hs02_00309834 predicted 1482
8 SASI_Hs02_00309835 predicted 1392
9 SASI_Hs02_00309836 predicted 1415
10 SASI_Hs02_00309837 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309838 predicted 1999
2 SASI_Hs02_00309839 predicted 2009
3 SASI_Hs02_00309840 predicted 1879
4 SASI_Hs02_00309841 predicted 1892
5 SASI_Hs02_00309842 predicted 1351
6 SASI_Hs02_00309843 predicted 1280
7 SASI_Hs02_00309844 predicted 1431
8 SASI_Hs02_00309845 predicted 1332
9 SASI_Hs02_00309846 predicted 1356
10 SASI_Hs02_00309847 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129406 predicted 2437
2 SASI_Hs01_00129407 predicted 2439
3 SASI_Hs01_00129408 predicted 2318
4 SASI_Hs01_00129409 predicted 2324
5 SASI_Hs01_00129410 predicted 1783
6 SASI_Hs01_00129411 predicted 1706
7 SASI_Hs01_00129412 predicted 1867
8 SASI_Hs01_00129413 predicted 1765
9 SASI_Hs01_00129414 predicted 1786
10 SASI_Hs01_00129415 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183060 predicted 2097
2 SASI_Hs01_00183061 predicted 2107
3 SASI_Hs01_00183062 predicted 1977
4 SASI_Hs01_00183063 predicted 1988
5 SASI_Hs01_00183064 predicted 1450
6 SASI_Hs01_00183065 predicted 1370
7 SASI_Hs01_00183066 predicted 1521
8 SASI_Hs01_00183067 predicted 1430
9 SASI_Hs01_00183068 predicted 1450
10 SASI_Hs01_00183069 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037439 predicted 1248
2 SASI_Hs01_00037440 predicted 1257
3 SASI_Hs01_00037441 predicted 1140
4 SASI_Hs01_00037442 predicted 1144
5 SASI_Hs01_00037443 predicted 611
6 SASI_Hs01_00037444 predicted 528
7 SASI_Hs01_00037445 predicted 684
8 SASI_Hs01_00037446 predicted 584
9 SASI_Hs01_00037447 predicted 610
10 SASI_Hs01_00037448 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244654 predicted 1949
2 SASI_Hs01_00244655 predicted 1950
3 SASI_Hs01_00244656 predicted 1834
4 SASI_Hs01_00244657 predicted 1835
5 SASI_Hs01_00244658 predicted 1302
6 SASI_Hs01_00244659 predicted 1228
7 SASI_Hs01_00244660 predicted 1377
8 SASI_Hs01_00244661 predicted 1276
9 SASI_Hs01_00244662 predicted 1298
10 SASI_Hs01_00244663 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368046 predicted 2328
2 SASI_Hs02_00368047 predicted 2340
3 SASI_Hs02_00368048 predicted 2211
4 SASI_Hs02_00368049 predicted 2218
5 SASI_Hs02_00368050 predicted 1684
6 SASI_Hs02_00368051 predicted 1608
7 SASI_Hs02_00368052 predicted 1756
8 SASI_Hs02_00368053 predicted 1661
9 SASI_Hs02_00368054 predicted 1683
10 SASI_Hs02_00368055 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035201 predicted 1290
2 SASI_Rn01_00035202 predicted 2264
3 SASI_Rn02_00203750 predicted 1079
4 SASI_Rn01_00035203 predicted 1808
5 SASI_Rn02_00203751 predicted 2156
6 SASI_Rn01_00035206 predicted 1806
7 SASI_Rn01_00035207 predicted 1218
8 SASI_Rn01_00035208 predicted 832
9 SASI_Rn01_00035209 predicted 2048
10 SASI_Rn02_00203752 predicted 1475
11 SASI_Rn01_00035204 predicted 814
12 SASI_Rn01_00035205 predicted 2165
13 SASI_Rn01_00035210 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118534 predicted 1226
2 SASI_Rn01_00118535 predicted 2195
3 SASI_Rn02_00203753 predicted 1005
4 SASI_Rn01_00118536 predicted 1746
5 SASI_Rn02_00203754 predicted 2088
6 SASI_Rn01_00118539 predicted 1738
7 SASI_Rn01_00118540 predicted 1141
8 SASI_Rn01_00118541 predicted 765
9 SASI_Rn01_00118542 predicted 1980
10 SASI_Rn02_00203755 predicted 1405
11 SASI_Rn01_00118537 predicted 739
12 SASI_Rn01_00118538 predicted 2091
13 SASI_Rn01_00118543 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097759 predicted 1409
2 SASI_Rn01_00097760 predicted 2377
3 SASI_Rn02_00265674 predicted 1188
4 SASI_Rn01_00097761 predicted 1922
5 SASI_Rn02_00265675 predicted 2263
6 SASI_Rn01_00097764 predicted 1913
7 SASI_Rn01_00097765 predicted 1324
8 SASI_Rn01_00097766 predicted 944
9 SASI_Rn01_00097767 predicted 2164
10 SASI_Rn02_00265676 predicted 1589
11 SASI_Rn01_00097762 predicted 927
12 SASI_Rn01_00097763 predicted 2280
13 SASI_Rn01_00097768 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144499 predicted 2330
2 SASI_Mm01_00144504 predicted 804
3 SASI_Mm01_00144505 predicted 1333
4 SASI_Mm01_00144507 predicted 902
5 SASI_Mm02_00317114 predicted 2433
6 SASI_Mm02_00317115 predicted 2085
7 SASI_Mm02_00317116 predicted 724
8 SASI_Mm02_00317117 predicted 451
9 SASI_Mm02_00317118 predicted 1056
10 SASI_Mm01_00144500 predicted 2334
11 SASI_Mm01_00144501 predicted 1292
12 SASI_Mm01_00144502 predicted 708
13 SASI_Mm01_00144503 predicted 1815
14 SASI_Mm01_00144506 predicted 1779
15 SASI_Mm01_00144508 predicted 2229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009817
VALIDATED
CAST MISSION shRNA Bacterial Glycerol Stock
calpastatin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-2154s1c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-738s1c1
Sequence:CCGGCCACCATATACTGGACCAGTACTCGAGTACTGGTCCAGTATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009817.1-819s1c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-1638s1c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009817.1-2680s1c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009817.3-2679s21c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-1637s21c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-2153s21c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-818s21c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009817
VALIDATED
CAST MISSION shRNA shRNA Plasmid DNA
calpastatin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-2154s1c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-738s1c1
Sequence:CCGGCCACCATATACTGGACCAGTACTCGAGTACTGGTCCAGTATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009817.1-819s1c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-1638s1c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009817.1-2680s1c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009817.3-2679s21c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-1637s21c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-2153s21c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-818s21c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009817
VALIDATED
CAST MISSION shRNA Lentiviral Transduction Particles
calpastatin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-2154s1c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-738s1c1
Sequence:CCGGCCACCATATACTGGACCAGTACTCGAGTACTGGTCCAGTATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009817.1-819s1c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009817.1-1638s1c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009817.1-2680s1c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009817.3-2679s21c1
Sequence:CCGGGCCTGTAAATCTCATTAGTATCTCGAGATACTAATGAGATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-1637s21c1
Sequence:CCGGCCTCCTGATTATCGACTAGAACTCGAGTTCTAGTCGATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-2153s21c1
Sequence:CCGGGCCCTCTCAGAAGATTTGGATCTCGAGATCCAAATCTTCTGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009817.3-818s21c1
Sequence:CCGGCCTCCAGAGTATAGGAAACTTCTCGAGAAGTTTCCTATACTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001750
VALIDATED
CAST MISSION shRNA Bacterial Glycerol Stock
calpastatin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-522s1c1
Sequence:CCGGGCTGTGCCAGTTGAATCTAAACTCGAGTTTAGATTCAACTGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-529s1c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1338s1c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1498s1c1
Sequence:CCGGCCAAAGAAGAAGACCGTGAAACTCGAGTTTCACGGTCTTCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-2257s1c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1048s21c1
Sequence:CCGGTATAGGGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-851s21c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001750.5-2579s21c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1660s21c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001750
VALIDATED
CAST MISSION shRNA shRNA Plasmid DNA
calpastatin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-522s1c1
Sequence:CCGGGCTGTGCCAGTTGAATCTAAACTCGAGTTTAGATTCAACTGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-529s1c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1338s1c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1498s1c1
Sequence:CCGGCCAAAGAAGAAGACCGTGAAACTCGAGTTTCACGGTCTTCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-2257s1c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1048s21c1
Sequence:CCGGTATAGGGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-851s21c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001750.5-2579s21c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1660s21c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001750
VALIDATED
CAST MISSION shRNA Lentiviral Transduction Particles
calpastatin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-522s1c1
Sequence:CCGGGCTGTGCCAGTTGAATCTAAACTCGAGTTTAGATTCAACTGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-529s1c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1338s1c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-1498s1c1
Sequence:CCGGCCAAAGAAGAAGACCGTGAAACTCGAGTTTCACGGTCTTCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001750.4-2257s1c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1048s21c1
Sequence:CCGGTATAGGGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-851s21c1
Sequence:CCGGCAGTTGAATCTAAACCGGATACTCGAGTATCCGGTTTAGATTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001750.5-2579s21c1
Sequence:CCGGGTATCTGGTATCTGCATGTAACTCGAGTTACATGCAGATACCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001750.5-1660s21c1
Sequence:CCGGCGGACCTCCATGTGTAGTATACTCGAGTATACTACACATGGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks