EMAIL THIS PAGE TO A FRIEND

CASZ1

castor zinc finger 1

151 Gene Product Result for
Synonyms: CAS11 CST SRG ZNF693 dJ734G22.1
Gene ID:
Human(54897) Summary: The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(69743) castor zinc finger 1
Rat(313713) castor zinc finger 1
Zebrafish(559053) castor zinc finger 1
cow(536765) castor zinc finger 1
Horse(100056838) castor zinc finger 1
domestic cat(101099311) castor zinc finger 1
dog(487448) castor zinc finger 1
chicken(419452) castor zinc finger 1
domestic guinea pig(100726563) castor zinc finger 1
naked mole-rat(101698817) castor zinc finger 1
sheep(101112837) castor zinc finger 1
Domestic Rabbit(100355213) castor zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079843 Rosetta Predictions human pricing
NM_017766 Rosetta Predictions human pricing
XM_243038 Rosetta Predictions rat pricing
XR_009017 Rosetta Predictions rat pricing
NM_027195 Rosetta Predictions mouse pricing
XM_001003235 Rosetta Predictions mouse pricing
XM_001003246 Rosetta Predictions mouse pricing
XM_001003253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313890 predicted 1695
2 SASI_Hs02_00313891 predicted 2241
3 SASI_Hs02_00313892 predicted 3104
4 SASI_Hs02_00313893 predicted 3456
5 SASI_Hs02_00313894 predicted 876
6 SASI_Hs02_00313895 predicted 2125
7 SASI_Hs02_00313896 predicted 2176
8 SASI_Hs02_00313897 predicted 2185
9 SASI_Hs02_00313898 predicted 1247
10 SASI_Hs02_00313899 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350592 predicted 1695
2 SASI_Hs01_00065031 predicted 2246
3 SASI_Hs01_00065032 predicted 3106
4 SASI_Hs01_00065033 predicted 3455
5 SASI_Hs01_00065034 predicted 875
6 SASI_Hs01_00065036 predicted 2128
7 SASI_Hs01_00065037 predicted 2178
8 SASI_Hs01_00065038 predicted 2186
9 SASI_Hs01_00065039 predicted 1240
10 SASI_Hs02_00350593 predicted 2207
11 SASI_Hs01_00065030 predicted 2819
12 SASI_Hs01_00065035 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123634 predicted 1962
2 SASI_Rn01_00123635 predicted 2249
3 SASI_Rn01_00123636 predicted 3453
4 SASI_Rn01_00123637 predicted 3105
5 SASI_Rn01_00123638 predicted 2449
6 SASI_Rn01_00123639 predicted 1549
7 SASI_Rn01_00123640 predicted 826
8 SASI_Rn01_00123641 predicted 1208
9 SASI_Rn01_00123642 predicted 2168
10 SASI_Rn01_00123643 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144376 predicted 2259
2 SASI_Rn02_00418497 predicted 1680
3 SASI_Rn01_00144377 predicted 4499
4 SASI_Rn01_00144378 predicted 3001
5 SASI_Rn01_00144379 predicted 693
6 SASI_Rn02_00418498 predicted 3925
7 SASI_Rn02_00418499 predicted 2998
8 SASI_Rn01_00144380 predicted 3668
9 SASI_Rn02_00418500 predicted 2090
10 SASI_Rn01_00144383 predicted 3884
11 SASI_Rn01_00144381 predicted 3242
12 SASI_Rn01_00144382 predicted 817
13 SASI_Rn01_00144384 predicted 4813
14 SASI_Rn01_00144385 predicted 3844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331732 predicted 856
2 SASI_Mm02_00331733 predicted 1725
3 SASI_Mm02_00331734 predicted 1869
4 SASI_Mm02_00331735 predicted 2207
5 SASI_Mm02_00331736 predicted 1777
6 SASI_Mm02_00331737 predicted 2791
7 SASI_Mm02_00331738 predicted 1071
8 SASI_Mm02_00331739 predicted 906
9 SASI_Mm02_00331740 predicted 2154
10 SASI_Mm02_00331741 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213015 predicted 693
2 SASI_Mm01_00213016 predicted 1558
3 SASI_Mm01_00213017 predicted 1708
4 SASI_Mm01_00213018 predicted 2042
5 SASI_Mm01_00213019 predicted 1622
6 SASI_Mm01_00213020 predicted 2619
7 SASI_Mm01_00213021 predicted 904
8 SASI_Mm01_00213022 predicted 742
9 SASI_Mm01_00213023 predicted 1995
10 SASI_Mm01_00213024 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237339 predicted 691
2 SASI_Mm01_00237340 predicted 1705
3 SASI_Mm01_00237341 predicted 2048
4 SASI_Mm01_00237342 predicted 1616
5 SASI_Mm01_00237343 predicted 2622
6 SASI_Mm01_00237344 predicted 910
7 SASI_Mm01_00237345 predicted 750
8 SASI_Mm01_00237346 predicted 3332
9 SASI_Mm01_00237347 predicted 1992
10 SASI_Mm01_00237348 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270757 predicted 861
2 SASI_Mm01_00270758 predicted 1869
3 SASI_Mm01_00270759 predicted 2216
4 SASI_Mm01_00270760 predicted 1787
5 SASI_Mm01_00270761 predicted 2791
6 SASI_Mm01_00270762 predicted 1075
7 SASI_Mm01_00270763 predicted 912
8 SASI_Mm01_00270764 predicted 3500
9 SASI_Mm01_00270765 predicted 2163
10 SASI_Mm01_00270766 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017766
CASZ1 MISSION shRNA Bacterial Glycerol Stock
castor zinc finger 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1304s21c1
Sequence:CCGGGAACGGGAGCACCTACAAGAACTCGAGTTCTTGTAGGTGCTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-2020s21c1
Sequence:CCGGACGTGATGACCCACGAGAACTCTCGAGAGTTCTCGTGGGTCATCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1794s21c1
Sequence:CCGCTGCCTTGACCCTGAGTGTAACCTCGAGGTTACACTCAGGGTCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-2855s1c1
Sequence:CCGGGTCCCGGCAAATTCATCTCTTCTCGAGAAGAGATGAATTTGCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1291s1c1
Sequence:CCGGCGAGTACCTGAAGTCAACCTTCTCGAGAAGGTTGACTTCAGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1384s1c1
Sequence:CCGGCGTCACTGAAGATGTAAACATCTCGAGATGTTTACATCTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-724s1c1
Sequence:CCGGCTCTAAGTATGAGGAGTACATCTCGAGATGTACTCCTCATACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017766.2-3454s1c1
Sequence:CCGGGACTTCTCTAGAGAACGCCAACTCGAGTTGGCGTTCTCTAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1861s1c1
Sequence:CCGGCGGCTGCACATTCACTTTCAACTCGAGTTGAAAGTGAATGTGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017766
CASZ1 MISSION shRNA shRNA Plasmid DNA
castor zinc finger 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1304s21c1
Sequence:CCGGGAACGGGAGCACCTACAAGAACTCGAGTTCTTGTAGGTGCTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-2020s21c1
Sequence:CCGGACGTGATGACCCACGAGAACTCTCGAGAGTTCTCGTGGGTCATCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1794s21c1
Sequence:CCGCTGCCTTGACCCTGAGTGTAACCTCGAGGTTACACTCAGGGTCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-2855s1c1
Sequence:CCGGGTCCCGGCAAATTCATCTCTTCTCGAGAAGAGATGAATTTGCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1291s1c1
Sequence:CCGGCGAGTACCTGAAGTCAACCTTCTCGAGAAGGTTGACTTCAGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1384s1c1
Sequence:CCGGCGTCACTGAAGATGTAAACATCTCGAGATGTTTACATCTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-724s1c1
Sequence:CCGGCTCTAAGTATGAGGAGTACATCTCGAGATGTACTCCTCATACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017766.2-3454s1c1
Sequence:CCGGGACTTCTCTAGAGAACGCCAACTCGAGTTGGCGTTCTCTAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1861s1c1
Sequence:CCGGCGGCTGCACATTCACTTTCAACTCGAGTTGAAAGTGAATGTGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017766
CASZ1 MISSION shRNA Lentiviral Transduction Particles
castor zinc finger 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1304s21c1
Sequence:CCGGGAACGGGAGCACCTACAAGAACTCGAGTTCTTGTAGGTGCTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-2020s21c1
Sequence:CCGGACGTGATGACCCACGAGAACTCTCGAGAGTTCTCGTGGGTCATCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017766.3-1794s21c1
Sequence:CCGCTGCCTTGACCCTGAGTGTAACCTCGAGGTTACACTCAGGGTCAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-2855s1c1
Sequence:CCGGGTCCCGGCAAATTCATCTCTTCTCGAGAAGAGATGAATTTGCCGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1291s1c1
Sequence:CCGGCGAGTACCTGAAGTCAACCTTCTCGAGAAGGTTGACTTCAGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1384s1c1
Sequence:CCGGCGTCACTGAAGATGTAAACATCTCGAGATGTTTACATCTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-724s1c1
Sequence:CCGGCTCTAAGTATGAGGAGTACATCTCGAGATGTACTCCTCATACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017766.2-3454s1c1
Sequence:CCGGGACTTCTCTAGAGAACGCCAACTCGAGTTGGCGTTCTCTAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017766.2-1861s1c1
Sequence:CCGGCGGCTGCACATTCACTTTCAACTCGAGTTGAAAGTGAATGTGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027195
CASZ1 MISSION shRNA Bacterial Glycerol Stock
castor zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1696s21c1
Sequence:CCGGACGGATTGCCCACAGATAAACCTCGAGGTTTATCTGTGGGCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1868s21c1
Sequence:CCGGGCAGGATGTGATCCGACATTACTCGAGTAATGTCGGATCACATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027195.2-4178s21c1
Sequence:CCGGATACCCAGGCTGAGTCAATAGCTCGAGCTATTGACTCAGCCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-616s21c1
Sequence:CCGGTGATCGAGAAATGGGTCAATGCTCGAGCATTGACCCATTTCTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-2300s21c1
Sequence:CCGGCAAGTACGAGGAGTGCAAATACTCGAGTATTTGCACTCCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027195
CASZ1 MISSION shRNA shRNA Plasmid DNA
castor zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1696s21c1
Sequence:CCGGACGGATTGCCCACAGATAAACCTCGAGGTTTATCTGTGGGCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1868s21c1
Sequence:CCGGGCAGGATGTGATCCGACATTACTCGAGTAATGTCGGATCACATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027195.2-4178s21c1
Sequence:CCGGATACCCAGGCTGAGTCAATAGCTCGAGCTATTGACTCAGCCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-616s21c1
Sequence:CCGGTGATCGAGAAATGGGTCAATGCTCGAGCATTGACCCATTTCTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-2300s21c1
Sequence:CCGGCAAGTACGAGGAGTGCAAATACTCGAGTATTTGCACTCCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027195
CASZ1 MISSION shRNA Lentiviral Transduction Particles
castor zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1696s21c1
Sequence:CCGGACGGATTGCCCACAGATAAACCTCGAGGTTTATCTGTGGGCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-1868s21c1
Sequence:CCGGGCAGGATGTGATCCGACATTACTCGAGTAATGTCGGATCACATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027195.2-4178s21c1
Sequence:CCGGATACCCAGGCTGAGTCAATAGCTCGAGCTATTGACTCAGCCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-616s21c1
Sequence:CCGGTGATCGAGAAATGGGTCAATGCTCGAGCATTGACCCATTTCTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027195.2-2300s21c1
Sequence:CCGGCAAGTACGAGGAGTGCAAATACTCGAGTATTTGCACTCCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks