EMAIL THIS PAGE TO A FRIEND

CAT

catalase

61 Gene Product Result for
Gene ID:
Human(847) Summary: This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
Mouse(12359) catalase
Rat(24248) catalase
Goat(100860855) catalase
sheep(100307035) catalase
Zebrafish(30068) catalase
cow(531682) catalase
dog(403474) catalase
chicken(423600) catalase
fruit fly(40048) Catalase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405562 Anti-CAT antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2701680 Anti-cat antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA051282 Anti-CAT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA055838 Anti-CAT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105074 Anti-CAT antibody produced in rabbit affinity isolated antibody goat, human, mouse, rabbit, canine, horse, guinea pig, sheep
western blot pricing
SAB4503383 Anti-Catalase antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB2500200 Anti-Catalase/CAT antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4504127 Anti-phospho-Catalase (pTyr385) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1402140 Monoclonal Anti-CAT, (N-terminal) antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
C0979 Monoclonal Anti-Catalase antibody produced in mouse ~2 mg/mL, clone CAT-505, purified immunoglobulin, buffered aqueous solution human, mouse, bovine, rat
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0687 AQUA Peptide AFYVNVLNEEQ[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001752 Rosetta Predictions human pricing
NM_012520 Rosetta Predictions rat pricing
NM_009804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332471 predicted 1030
2 SASI_Hs01_00092507 predicted 329
3 SASI_Hs01_00092508 predicted 1038
4 SASI_Hs01_00092509 predicted 987
5 SASI_Hs01_00092510 predicted 1410
6 SASI_Hs01_00092511 predicted 957
7 SASI_Hs01_00092512 predicted 1603
8 SASI_Hs01_00092513 predicted 278
9 SASI_Hs01_00092514 predicted 963
10 SASI_Hs01_00092515 predicted 1304
11 SASI_Hs01_00092516 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053417 predicted 946
2 SASI_Rn01_00053418 predicted 1473
3 SASI_Rn02_00259594 predicted 479
4 SASI_Rn01_00053420 predicted 957
5 SASI_Rn01_00053421 predicted 1034
6 SASI_Rn01_00053422 predicted 993
7 SASI_Rn01_00053423 predicted 712
8 SASI_Rn01_00053424 predicted 848
9 SASI_Rn01_00053425 predicted 1366
10 SASI_Rn01_00053426 predicted 560
11 SASI_Rn01_00053419 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118362 predicted 599
2 SASI_Mm01_00118363 predicted 737
3 SASI_Mm01_00118364 predicted 377
4 SASI_Mm01_00118365 predicted 691
5 SASI_Mm01_00118366 predicted 769
6 SASI_Mm01_00118367 predicted 1020
7 SASI_Mm01_00118368 predicted 1404
8 SASI_Mm01_00118369 predicted 1000
9 SASI_Mm02_00317083 predicted 213
10 SASI_Mm01_00118370 predicted 1531
11 SASI_Mm01_00118371 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009804
VALIDATED
CAT MISSION shRNA Bacterial Glycerol Stock
catalase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009804.1-1051s1c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1969s1c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1012s1c1
Sequence:CCGGCCTCTTATACCAGTTGGCAAACTCGAGTTTGCCAACTGGTATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1011s1c1
Sequence:CCGGCCCTCTTATACCAGTTGGCAACTCGAGTTGCCAACTGGTATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-560s1c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-1079s21c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-588s21c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009804.2-1997s21c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-876s21c1
Sequence:CCGGCTCAGGAAGATCCGGATTATGCTCGAGCATAATCCGGATCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009804
VALIDATED
CAT MISSION shRNA shRNA Plasmid DNA
catalase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009804.1-1051s1c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1969s1c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1012s1c1
Sequence:CCGGCCTCTTATACCAGTTGGCAAACTCGAGTTTGCCAACTGGTATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1011s1c1
Sequence:CCGGCCCTCTTATACCAGTTGGCAACTCGAGTTGCCAACTGGTATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-560s1c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-1079s21c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-588s21c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009804.2-1997s21c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-876s21c1
Sequence:CCGGCTCAGGAAGATCCGGATTATGCTCGAGCATAATCCGGATCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009804
VALIDATED
CAT MISSION shRNA Lentiviral Transduction Particles
catalase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009804.1-1051s1c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1969s1c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1012s1c1
Sequence:CCGGCCTCTTATACCAGTTGGCAAACTCGAGTTTGCCAACTGGTATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-1011s1c1
Sequence:CCGGCCCTCTTATACCAGTTGGCAACTCGAGTTGCCAACTGGTATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009804.1-560s1c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-1079s21c1
Sequence:CCGGCCAGTTAATTACTTTGCTGAACTCGAGTTCAGCAAAGTAATTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-588s21c1
Sequence:CCGGCCATATTGTTTCCATCCTTTACTCGAGTAAAGGATGGAAACAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009804.2-1997s21c1
Sequence:CCGGGCCAGAAACATGACTTGATTACTCGAGTAATCAAGTCATGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009804.2-876s21c1
Sequence:CCGGCTCAGGAAGATCCGGATTATGCTCGAGCATAATCCGGATCTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001752
VALIDATED
CAT MISSION shRNA Bacterial Glycerol Stock
catalase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1371s1c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-712s1c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001752.2-1017s1c1
Sequence:CCGGCCAGTTGGTAAACTGGTCTTACTCGAGTAAGACCAGTTTACCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1719s1c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-254s1c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-712s21c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001752.2-1719s21c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-1371s21c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-254s21c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001752
VALIDATED
CAT MISSION shRNA shRNA Plasmid DNA
catalase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1371s1c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-712s1c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001752.2-1017s1c1
Sequence:CCGGCCAGTTGGTAAACTGGTCTTACTCGAGTAAGACCAGTTTACCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1719s1c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-254s1c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-712s21c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001752.2-1719s21c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-1371s21c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-254s21c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001752
VALIDATED
CAT MISSION shRNA Lentiviral Transduction Particles
catalase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1371s1c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-712s1c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001752.2-1017s1c1
Sequence:CCGGCCAGTTGGTAAACTGGTCTTACTCGAGTAAGACCAGTTTACCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-1719s1c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001752.2-254s1c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-712s21c1
Sequence:CCGGGCCACATGAATGGATATGGATCTCGAGATCCATATCCATTCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001752.2-1719s21c1
Sequence:CCGGCGCTCATCACTGGATGAAGATCTCGAGATCTTCATCCAGTGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-1371s21c1
Sequence:CCGGCGGAGATTCAACACTGCCAATCTCGAGATTGGCAGTGTTGAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001752.2-254s21c1
Sequence:CCGGCACTGATGAAATGGCTCATTTCTCGAGAAATGAGCCATTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks