EMAIL THIS PAGE TO A FRIEND

CATSPER1

cation channel, sperm associated 1

41 Gene Product Result for
Synonyms: CATSPER SPGF7
UniProtKB ID: Q8NEC5, Q96P76
Gene ID:
Human(117144) Summary: Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
Mouse(225865) cation channel, sperm associated 1
Rat(689349) cation channel, sperm associated 1
dog(476016) cation channel, sperm associated 1
cow(523556) cation channel, sperm associated 1
Horse(100058005) cation channel, sperm associated 1
domestic cat(101098578) cation channel, sperm associated 1
domestic guinea pig(100726828) cation channel, sperm associated 1
naked mole-rat(101714404) cation channel, sperm associated 1
sheep(101103937) cation channel, sperm associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000901 MISSION® esiRNA esiRNA targeting human CATSPER1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053054 Rosetta Predictions human pricing
XM_001070492 Rosetta Predictions rat pricing
NM_139301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066697 predicted 518
2 SASI_Hs01_00066698 predicted 590
3 SASI_Hs01_00066699 predicted 2079
4 SASI_Hs01_00066700 predicted 595
5 SASI_Hs01_00066702 predicted 1428
6 SASI_Hs01_00066703 predicted 504
7 SASI_Hs01_00066704 predicted 1730
8 SASI_Hs01_00066705 predicted 1742
9 SASI_Hs01_00066706 predicted 2254
10 SASI_Hs02_00361897 predicted 459
11 SASI_Hs01_00066701 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331868 predicted 943
2 SASI_Rn02_00331869 predicted 485
3 SASI_Rn02_00331870 predicted 632
4 SASI_Rn02_00331871 predicted 777
5 SASI_Rn02_00331872 predicted 299
6 SASI_Rn02_00331873 predicted 486
7 SASI_Rn02_00331874 predicted 1160
8 SASI_Rn02_00331875 predicted 1442
9 SASI_Rn02_00331876 predicted 1313
10 SASI_Rn02_00331877 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023518 predicted 637
2 SASI_Mm01_00023519 predicted 1240
3 SASI_Mm01_00023520 predicted 519
4 SASI_Mm01_00023521 predicted 1017
5 SASI_Mm01_00023522 predicted 412
6 SASI_Mm01_00023523 predicted 1138
7 SASI_Mm01_00023524 predicted 1059
8 SASI_Mm01_00023525 predicted 691
9 SASI_Mm02_00339991 predicted 1573
10 SASI_Mm01_00023526 predicted 1832
11 SASI_Mm01_00023517 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053054
CATSPER1 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-1057s21c1
Sequence:CCGGGGCGCGTATCATTCCAGTTACCTCGAGGTAACTGGAATGATACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-908s21c1
Sequence:CCGGAGCGTGGGATATCTGACTATCCTCGAGGATAGTCAGATATCCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-589s1c1
Sequence:CCGGCCCAATATCTCGGTGAGAATTCTCGAGAATTCTCACCGAGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1643s1c1
Sequence:CCGGCCTCTCGTACTTCTTTGACTTCTCGAGAAGTCAAAGAAGTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-174s1c1
Sequence:CCGGGCAGACACCAATAACGCAGATCTCGAGATCTGCGTTATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1898s1c1
Sequence:CCGGCCTCATGTTTACCTGCCTCTTCTCGAGAAGAGGCAGGTAAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1465s1c1
Sequence:CCGGCCCAATCCTTGGCCTTTGAAACTCGAGTTTCAAAGGCCAAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053054
CATSPER1 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-1057s21c1
Sequence:CCGGGGCGCGTATCATTCCAGTTACCTCGAGGTAACTGGAATGATACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-908s21c1
Sequence:CCGGAGCGTGGGATATCTGACTATCCTCGAGGATAGTCAGATATCCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-589s1c1
Sequence:CCGGCCCAATATCTCGGTGAGAATTCTCGAGAATTCTCACCGAGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1643s1c1
Sequence:CCGGCCTCTCGTACTTCTTTGACTTCTCGAGAAGTCAAAGAAGTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-174s1c1
Sequence:CCGGGCAGACACCAATAACGCAGATCTCGAGATCTGCGTTATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1898s1c1
Sequence:CCGGCCTCATGTTTACCTGCCTCTTCTCGAGAAGAGGCAGGTAAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1465s1c1
Sequence:CCGGCCCAATCCTTGGCCTTTGAAACTCGAGTTTCAAAGGCCAAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053054
CATSPER1 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-1057s21c1
Sequence:CCGGGGCGCGTATCATTCCAGTTACCTCGAGGTAACTGGAATGATACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053054.3-908s21c1
Sequence:CCGGAGCGTGGGATATCTGACTATCCTCGAGGATAGTCAGATATCCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-589s1c1
Sequence:CCGGCCCAATATCTCGGTGAGAATTCTCGAGAATTCTCACCGAGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1643s1c1
Sequence:CCGGCCTCTCGTACTTCTTTGACTTCTCGAGAAGTCAAAGAAGTACGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-174s1c1
Sequence:CCGGGCAGACACCAATAACGCAGATCTCGAGATCTGCGTTATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1898s1c1
Sequence:CCGGCCTCATGTTTACCTGCCTCTTCTCGAGAAGAGGCAGGTAAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053054.2-1465s1c1
Sequence:CCGGCCCAATCCTTGGCCTTTGAAACTCGAGTTTCAAAGGCCAAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139301
CATSPER1 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1870s1c1
Sequence:CCGGGCCTTGAAGATGCAGCTTATTCTCGAGAATAAGCTGCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1311s1c1
Sequence:CCGGGCTCTCATATTCATTCTACAACTCGAGTTGTAGAATGAATATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-373s1c1
Sequence:CCGGCCTCGTATTGACCCGAATCATCTCGAGATGATTCGGGTCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1345s1c1
Sequence:CCGGCGGATTCTCAAAGTCTTCAAACTCGAGTTTGAAGACTTTGAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1134s1c1
Sequence:CCGGCCGAGGTGAATGGTACTTCATCTCGAGATGAAGTACCATTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139301
CATSPER1 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1870s1c1
Sequence:CCGGGCCTTGAAGATGCAGCTTATTCTCGAGAATAAGCTGCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1311s1c1
Sequence:CCGGGCTCTCATATTCATTCTACAACTCGAGTTGTAGAATGAATATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-373s1c1
Sequence:CCGGCCTCGTATTGACCCGAATCATCTCGAGATGATTCGGGTCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1345s1c1
Sequence:CCGGCGGATTCTCAAAGTCTTCAAACTCGAGTTTGAAGACTTTGAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1134s1c1
Sequence:CCGGCCGAGGTGAATGGTACTTCATCTCGAGATGAAGTACCATTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139301
CATSPER1 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1870s1c1
Sequence:CCGGGCCTTGAAGATGCAGCTTATTCTCGAGAATAAGCTGCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1311s1c1
Sequence:CCGGGCTCTCATATTCATTCTACAACTCGAGTTGTAGAATGAATATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-373s1c1
Sequence:CCGGCCTCGTATTGACCCGAATCATCTCGAGATGATTCGGGTCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1345s1c1
Sequence:CCGGCGGATTCTCAAAGTCTTCAAACTCGAGTTTGAAGACTTTGAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139301.1-1134s1c1
Sequence:CCGGCCGAGGTGAATGGTACTTCATCTCGAGATGAAGTACCATTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks