EMAIL THIS PAGE TO A FRIEND

CATSPER2

cation channel, sperm associated 2

155 Gene Product Result for
UniProtKB ID: Q96P56, Q8NHT9, Q96P54, Q96P55
Gene ID:
Human(117155) Summary: Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Additional splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Aug 2008]
Mouse(212670) cation channel, sperm associated 2
Rat(366174) cation channel, sperm associated 2
sheep(101109215) cation channel, sperm associated 2
Domestic Rabbit(100337752) cation channel, sperm associated 2
naked mole-rat(101710719) cation channel, sperm associated 2
domestic guinea pig(100715991) cation channel, sperm associated 2
dog(609008) cation channel, sperm associated 2
cow(517699) cation channel, sperm associated 2
Horse(100070776) cation channel, sperm associated 2
domestic cat(101097488) cation channel, sperm associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054020 Rosetta Predictions human pricing
NM_172095 Rosetta Predictions human pricing
NM_172097 Rosetta Predictions human pricing
NM_001012220 Rosetta Predictions rat pricing
NM_153075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361935 predicted 379
2 SASI_Hs02_00361936 predicted 520
3 SASI_Hs02_00361937 predicted 391
4 SASI_Hs02_00361938 predicted 405
5 SASI_Hs01_00104142 predicted 334
6 SASI_Hs01_00104145 predicted 336
7 SASI_Hs02_00361939 predicted 398
8 SASI_Hs02_00361940 predicted 399
9 SASI_Hs02_00361941 predicted 398
10 SASI_Hs02_00361942 predicted 335
11 SASI_Hs01_00104141 predicted 584
12 SASI_Hs01_00104143 predicted 884
13 SASI_Hs01_00104144 predicted 987
14 SASI_Hs01_00104146 predicted 1097
15 SASI_Hs01_00104147 predicted 1065
16 SASI_Hs01_00104148 predicted 1097
17 SASI_Hs01_00104149 predicted 1079
18 SASI_Hs01_00104150 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367808 predicted 374
2 SASI_Hs02_00367809 predicted 519
3 SASI_Hs02_00367810 predicted 395
4 SASI_Hs02_00367811 predicted 408
5 SASI_Hs01_00145180 predicted 333
6 SASI_Hs01_00145183 predicted 335
7 SASI_Hs02_00367812 predicted 404
8 SASI_Hs02_00367813 predicted 403
9 SASI_Hs02_00367814 predicted 398
10 SASI_Hs02_00367815 predicted 337
11 SASI_Hs01_00145179 predicted 583
12 SASI_Hs01_00145181 predicted 886
13 SASI_Hs01_00145182 predicted 988
14 SASI_Hs01_00145184 predicted 1089
15 SASI_Hs01_00145185 predicted 1061
16 SASI_Hs01_00145186 predicted 1101
17 SASI_Hs01_00145187 predicted 1082
18 SASI_Hs01_00145188 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053975 predicted 262
2 SASI_Hs01_00053978 predicted 421
3 SASI_Hs01_00053979 predicted 396
4 SASI_Hs02_00367816 predicted 253
5 SASI_Hs02_00367817 predicted 402
6 SASI_Hs01_00053981 predicted 336
7 SASI_Hs01_00053982 predicted 268
8 SASI_Hs01_00053983 predicted 403
9 SASI_Hs02_00367818 predicted 485
10 SASI_Hs02_00367819 predicted 383
11 SASI_Hs01_00053976 predicted 663
12 SASI_Hs01_00053977 predicted 584
13 SASI_Hs01_00053980 predicted 668
14 SASI_Hs01_00053984 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121953 predicted 1326
2 SASI_Rn01_00121954 predicted 785
3 SASI_Rn01_00121955 predicted 1003
4 SASI_Rn01_00121956 predicted 1227
5 SASI_Rn02_00200476 predicted 1114
6 SASI_Rn01_00121957 predicted 665
7 SASI_Rn02_00200477 predicted 1358
8 SASI_Rn01_00121959 predicted 1011
9 SASI_Rn01_00121960 predicted 729
10 SASI_Rn01_00121961 predicted 492
11 SASI_Rn01_00121952 predicted 835
12 SASI_Rn01_00121958 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342901 predicted 503
2 SASI_Mm01_00116303 predicted 1033
3 SASI_Mm01_00116304 predicted 1145
4 SASI_Mm01_00116305 predicted 811
5 SASI_Mm01_00116306 predicted 1241
6 SASI_Mm01_00116307 predicted 1211
7 SASI_Mm01_00116308 predicted 788
8 SASI_Mm02_00342902 predicted 1838
9 SASI_Mm01_00116310 predicted 1296
10 SASI_Mm02_00342903 predicted 1255
11 SASI_Mm01_00116309 predicted 1016
12 SASI_Mm01_00116311 predicted 795
13 SASI_Mm01_00116312 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054020
CATSPER2 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1461s1c1
Sequence:CCGGGCCACTGAAGAGGATTTAATACTCGAGTATTAAATCCTCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-336s1c1
Sequence:CCGGCGGCACACTATCAGGGAGTTACTCGAGTAACTCCCTGATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1552s1c1
Sequence:CCGGCCACATCCTCTTCCTATTCTTCTCGAGAAGAATAGGAAGAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-404s1c1
Sequence:CCGGGCTAGTGCGTTTCTCTATAAACTCGAGTTTATAGAGAAACGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-580s1c1
Sequence:CCGGCGATCATATTGATGGTTGAAACTCGAGTTTCAACCATCAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1434s21c1
Sequence:CCGGGTGTCTGAAGTAGAGTCTAATCTCGAGATTAGACTCTACTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1688s21c1
Sequence:CCGGAGACTCACTCTTCCGATATTTCTCGAGAAATATCGGAAGAGTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054020
CATSPER2 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1461s1c1
Sequence:CCGGGCCACTGAAGAGGATTTAATACTCGAGTATTAAATCCTCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-336s1c1
Sequence:CCGGCGGCACACTATCAGGGAGTTACTCGAGTAACTCCCTGATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1552s1c1
Sequence:CCGGCCACATCCTCTTCCTATTCTTCTCGAGAAGAATAGGAAGAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-404s1c1
Sequence:CCGGGCTAGTGCGTTTCTCTATAAACTCGAGTTTATAGAGAAACGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-580s1c1
Sequence:CCGGCGATCATATTGATGGTTGAAACTCGAGTTTCAACCATCAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1434s21c1
Sequence:CCGGGTGTCTGAAGTAGAGTCTAATCTCGAGATTAGACTCTACTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1688s21c1
Sequence:CCGGAGACTCACTCTTCCGATATTTCTCGAGAAATATCGGAAGAGTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054020
CATSPER2 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1461s1c1
Sequence:CCGGGCCACTGAAGAGGATTTAATACTCGAGTATTAAATCCTCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-336s1c1
Sequence:CCGGCGGCACACTATCAGGGAGTTACTCGAGTAACTCCCTGATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-1552s1c1
Sequence:CCGGCCACATCCTCTTCCTATTCTTCTCGAGAAGAATAGGAAGAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-404s1c1
Sequence:CCGGGCTAGTGCGTTTCTCTATAAACTCGAGTTTATAGAGAAACGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054020.2-580s1c1
Sequence:CCGGCGATCATATTGATGGTTGAAACTCGAGTTTCAACCATCAATATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1434s21c1
Sequence:CCGGGTGTCTGAAGTAGAGTCTAATCTCGAGATTAGACTCTACTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054020.2-1688s21c1
Sequence:CCGGAGACTCACTCTTCCGATATTTCTCGAGAAATATCGGAAGAGTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153075
CATSPER2 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-687s1c1
Sequence:CCGGCCTGAGTTAGTAGTGCTGTTACTCGAGTAACAGCACTACTAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1832s1c1
Sequence:CCGGGCGCAAGAAGTTACAAGAATTCTCGAGAATTCTTGTAACTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1285s1c1
Sequence:CCGGCCGAAGACATAATAGAAACTTCTCGAGAAGTTTCTATTATGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-165s1c1
Sequence:CCGGGCTATCCGTTCAAAGCTCATTCTCGAGAATGAGCTTTGAACGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1066s1c1
Sequence:CCGGGCAGCATCTATGTTATCCTTTCTCGAGAAAGGATAACATAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153075
CATSPER2 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-687s1c1
Sequence:CCGGCCTGAGTTAGTAGTGCTGTTACTCGAGTAACAGCACTACTAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1832s1c1
Sequence:CCGGGCGCAAGAAGTTACAAGAATTCTCGAGAATTCTTGTAACTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1285s1c1
Sequence:CCGGCCGAAGACATAATAGAAACTTCTCGAGAAGTTTCTATTATGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-165s1c1
Sequence:CCGGGCTATCCGTTCAAAGCTCATTCTCGAGAATGAGCTTTGAACGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1066s1c1
Sequence:CCGGGCAGCATCTATGTTATCCTTTCTCGAGAAAGGATAACATAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153075
CATSPER2 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-687s1c1
Sequence:CCGGCCTGAGTTAGTAGTGCTGTTACTCGAGTAACAGCACTACTAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1832s1c1
Sequence:CCGGGCGCAAGAAGTTACAAGAATTCTCGAGAATTCTTGTAACTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1285s1c1
Sequence:CCGGCCGAAGACATAATAGAAACTTCTCGAGAAGTTTCTATTATGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-165s1c1
Sequence:CCGGGCTATCCGTTCAAAGCTCATTCTCGAGAATGAGCTTTGAACGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153075.1-1066s1c1
Sequence:CCGGGCAGCATCTATGTTATCCTTTCTCGAGAAAGGATAACATAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks