EMAIL THIS PAGE TO A FRIEND

CATSPER3

cation channel, sperm associated 3

43 Gene Product Result for
Synonyms: CACRC
UniProtKB ID: Q86XQ3, Q86XS6
Gene ID:
Mouse(76856) cation channel, sperm associated 3
Rat(290989) cation channel, sperm associated 3
dog(481512) cation channel, sperm associated 3
domestic cat(101101438) cation channel, sperm associated 3
cow(540820) cation channel, sperm associated 3
domestic guinea pig(100730932) cation channel, sperm associated 3
naked mole-rat(101708699) cation channel, sperm associated 3
sheep(101104315) cation channel, sperm associated 3
Domestic Rabbit(100340055) cation channel, sperm associated 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301159 Anti-CATSPER3 antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB1301325 ANTI-CTSR3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021111 MISSION® esiRNA esiRNA human CATSPER3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178019 Rosetta Predictions human pricing
NM_001106101 Rosetta Predictions rat pricing
NM_029772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117718 predicted 298
2 SASI_Hs01_00117719 predicted 271
3 SASI_Hs01_00117720 predicted 200
4 SASI_Hs01_00117721 predicted 420
5 SASI_Hs01_00117722 predicted 478
6 SASI_Hs01_00117723 predicted 320
7 SASI_Hs02_00369502 predicted 302
8 SASI_Hs01_00117724 predicted 1069
9 SASI_Hs01_00117725 predicted 193
10 SASI_Hs01_00117726 predicted 477
11 SASI_Hs01_00117727 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215632 predicted 948
2 SASI_Rn02_00215633 predicted 355
3 SASI_Rn02_00215634 predicted 737
4 SASI_Rn02_00215635 predicted 323
5 SASI_Rn02_00215636 predicted 586
6 SASI_Rn02_00215637 predicted 272
7 SASI_Rn02_00215638 predicted 355
8 SASI_Rn02_00215639 predicted 318
9 SASI_Rn02_00215640 predicted 250
10 SASI_Rn02_00215641 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123482 predicted 292
2 SASI_Mm01_00123483 predicted 199
3 SASI_Mm01_00123484 predicted 489
4 SASI_Mm01_00123485 predicted 223
5 SASI_Mm01_00123486 predicted 387
6 SASI_Mm01_00123487 predicted 984
7 SASI_Mm01_00123488 predicted 628
8 SASI_Mm01_00123489 predicted 381
9 SASI_Mm01_00123490 predicted 387
10 SASI_Mm01_00123491 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178019
CATSPER3 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-1101s21c1
Sequence:CCGGAGCTTACCCTTCATCGATATCCTCGAGGATATCGATGAAGGGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-358s21c1
Sequence:CCGGAGTTGTCCATGAAGGTCTATGCTCGAGCATAGACCTTCATGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-423s21c1
Sequence:CCGGGTGATCATTATCATCGTTATGCTCGAGCATAACGATGATAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-189s1c1
Sequence:CCGGGCATTTGTGAAGAGAGTCATACTCGAGTATGACTCTCTTCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-770s1c1
Sequence:CCGGGCAGTTGGACAATCGGGAATTCTCGAGAATTCCCGATTGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-659s1c1
Sequence:CCGGCCTGTTTGGATCTCCAGACAACTCGAGTTGTCTGGAGATCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-173s1c1
Sequence:CCGGCGATGATGAATGTCGGGCATTCTCGAGAATGCCCGACATTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-1073s1c1
Sequence:CCGGCCCAATGGTCTTGGATGATTTCTCGAGAAATCATCCAAGACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178019
CATSPER3 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-1101s21c1
Sequence:CCGGAGCTTACCCTTCATCGATATCCTCGAGGATATCGATGAAGGGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-358s21c1
Sequence:CCGGAGTTGTCCATGAAGGTCTATGCTCGAGCATAGACCTTCATGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-423s21c1
Sequence:CCGGGTGATCATTATCATCGTTATGCTCGAGCATAACGATGATAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-189s1c1
Sequence:CCGGGCATTTGTGAAGAGAGTCATACTCGAGTATGACTCTCTTCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-770s1c1
Sequence:CCGGGCAGTTGGACAATCGGGAATTCTCGAGAATTCCCGATTGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-659s1c1
Sequence:CCGGCCTGTTTGGATCTCCAGACAACTCGAGTTGTCTGGAGATCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-173s1c1
Sequence:CCGGCGATGATGAATGTCGGGCATTCTCGAGAATGCCCGACATTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-1073s1c1
Sequence:CCGGCCCAATGGTCTTGGATGATTTCTCGAGAAATCATCCAAGACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178019
CATSPER3 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-1101s21c1
Sequence:CCGGAGCTTACCCTTCATCGATATCCTCGAGGATATCGATGAAGGGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-358s21c1
Sequence:CCGGAGTTGTCCATGAAGGTCTATGCTCGAGCATAGACCTTCATGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178019.1-423s21c1
Sequence:CCGGGTGATCATTATCATCGTTATGCTCGAGCATAACGATGATAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-189s1c1
Sequence:CCGGGCATTTGTGAAGAGAGTCATACTCGAGTATGACTCTCTTCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-770s1c1
Sequence:CCGGGCAGTTGGACAATCGGGAATTCTCGAGAATTCCCGATTGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-659s1c1
Sequence:CCGGCCTGTTTGGATCTCCAGACAACTCGAGTTGTCTGGAGATCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-173s1c1
Sequence:CCGGCGATGATGAATGTCGGGCATTCTCGAGAATGCCCGACATTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178019.1-1073s1c1
Sequence:CCGGCCCAATGGTCTTGGATGATTTCTCGAGAAATCATCCAAGACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029772
CATSPER3 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-128s1c1
Sequence:CCGGGCTCACTGTTTGCTACAGCATCTCGAGATGCTGTAGCAAACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-1116s1c1
Sequence:CCGGCCAAGATGTTATTGTCAGCAACTCGAGTTGCTGACAATAACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-489s1c1
Sequence:CCGGCCAGTCTCTACGAATCCTCAACTCGAGTTGAGGATTCGTAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-173s1c1
Sequence:CCGGGCAAGATTAAGAGGAAGGATACTCGAGTATCCTTCCTCTTAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-906s1c1
Sequence:CCGGCCTTGCGATTATGGAGGAGAACTCGAGTTCTCCTCCATAATCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029772
CATSPER3 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-128s1c1
Sequence:CCGGGCTCACTGTTTGCTACAGCATCTCGAGATGCTGTAGCAAACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-1116s1c1
Sequence:CCGGCCAAGATGTTATTGTCAGCAACTCGAGTTGCTGACAATAACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-489s1c1
Sequence:CCGGCCAGTCTCTACGAATCCTCAACTCGAGTTGAGGATTCGTAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-173s1c1
Sequence:CCGGGCAAGATTAAGAGGAAGGATACTCGAGTATCCTTCCTCTTAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-906s1c1
Sequence:CCGGCCTTGCGATTATGGAGGAGAACTCGAGTTCTCCTCCATAATCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029772
CATSPER3 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-128s1c1
Sequence:CCGGGCTCACTGTTTGCTACAGCATCTCGAGATGCTGTAGCAAACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-1116s1c1
Sequence:CCGGCCAAGATGTTATTGTCAGCAACTCGAGTTGCTGACAATAACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-489s1c1
Sequence:CCGGCCAGTCTCTACGAATCCTCAACTCGAGTTGAGGATTCGTAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-173s1c1
Sequence:CCGGGCAAGATTAAGAGGAAGGATACTCGAGTATCCTTCCTCTTAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029772.1-906s1c1
Sequence:CCGGCCTTGCGATTATGGAGGAGAACTCGAGTTCTCCTCCATAATCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks