EMAIL THIS PAGE TO A FRIEND

CATSPER4

cation channel, sperm associated 4

58 Gene Product Result for
UniProtKB ID: Q7RTX7, A1A4W6, Q5VY71
Gene ID:
Mouse(329954) cation channel, sperm associated 4
Rat(362623) cation channel, sperm associated 4
sheep(101116549) cation channel, sperm associated 4
naked mole-rat(101711164) cation channel, sperm associated 4
dog(487358) cation channel, sperm associated 4
cow(520788) cation channel, sperm associated 4
domestic cat(101085138) cation channel, sperm associated 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085761 MISSION® esiRNA esiRNA targeting mouse Catsper4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198137 Rosetta Predictions human pricing
XM_342941 Rosetta Predictions rat pricing
NM_001130030 Rosetta Predictions mouse pricing
NM_177866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056349 predicted 227
2 SASI_Hs01_00056350 predicted 469
3 SASI_Hs01_00056351 predicted 360
4 SASI_Hs01_00056352 predicted 966
5 SASI_Hs01_00056353 predicted 432
6 SASI_Hs01_00056354 predicted 886
7 SASI_Hs01_00056355 predicted 842
8 SASI_Hs02_00371674 predicted 875
9 SASI_Hs01_00056356 predicted 679
10 SASI_Hs01_00056357 predicted 468
11 SASI_Hs01_00056358 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395081 predicted 1664
2 SASI_Rn02_00395082 predicted 1427
3 SASI_Rn02_00395083 predicted 1719
4 SASI_Rn02_00395084 predicted 1485
5 SASI_Rn02_00395085 predicted 1549
6 SASI_Rn02_00395086 predicted 1626
7 SASI_Rn02_00395087 predicted 2116
8 SASI_Rn02_00395088 predicted 1979
9 SASI_Rn02_00395089 predicted 1513
10 SASI_Rn02_00395090 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310838 predicted 997
2 SASI_Mm02_00310839 predicted 716
3 SASI_Mm02_00310840 predicted 902
4 SASI_Mm02_00310841 predicted 926
5 SASI_Mm02_00310842 predicted 632
6 SASI_Mm02_00310843 predicted 630
7 SASI_Mm02_00310844 predicted 931
8 SASI_Mm02_00310845 predicted 628
9 SASI_Mm02_00310846 predicted 882
10 SASI_Mm02_00310847 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348348 predicted 1219
2 SASI_Mm02_00348349 predicted 931
3 SASI_Mm01_00061328 predicted 1124
4 SASI_Mm02_00348350 predicted 1141
5 SASI_Mm02_00348351 predicted 851
6 SASI_Mm01_00061332 predicted 852
7 SASI_Mm02_00348352 predicted 1151
8 SASI_Mm02_00348353 predicted 856
9 SASI_Mm02_00348354 predicted 1103
10 SASI_Mm01_00061335 predicted 1088
11 SASI_Mm01_00061326 predicted 431
12 SASI_Mm01_00061327 predicted 674
13 SASI_Mm01_00061329 predicted 448
14 SASI_Mm01_00061330 predicted 816
15 SASI_Mm01_00061331 predicted 759
16 SASI_Mm01_00061333 predicted 347
17 SASI_Mm01_00061334 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198137
CATSPER4 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-720s1c1
Sequence:CCGGGCCCAAGCATTTCCAGAACATCTCGAGATGTTCTGGAAATGCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-633s1c1
Sequence:CCGGGCCTGACATGGCCAATATCATCTCGAGATGATATTGGCCATGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-190s1c1
Sequence:CCGGCGCCAGGAAATCACGAACAAACTCGAGTTTGTTCGTGATTTCCTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-138s1c1
Sequence:CCGGGAGTACCATTCACGAGTCCTACTCGAGTAGGACTCGTGAATGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-753s1c1
Sequence:CCGGGTACACCCTCTTCATCTGCATCTCGAGATGCAGATGAAGAGGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-687s1c1
Sequence:CCGGCGTGTTTGGAGTAACACTCTTCTCGAGAAGAGTGTTACTCCAAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-465s1c1
Sequence:CCGGCTGGAACATCCTCAACTTCATCTCGAGATGAAGTTGAGGATGTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-354s1c1
Sequence:CCGGCCAGAAACACTATGAGTTGTTCTCGAGAACAACTCATAGTGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-1182s1c1
Sequence:CCGGCCGAGATGAACTCAACATGATCTCGAGATCATGTTGAGTTCATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-970s1c1
Sequence:CCGGCGAATAACCTTTAGTGAGACACTCGAGTGTCTCACTAAAGGTTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-858s1c1
Sequence:CCGGCTTTACCATCTTCATCACCATCTCGAGATGGTGATGAAGATGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-966s1c1
Sequence:CCGGGCAACGAATAACCTTTAGTGACTCGAGTCACTAAAGGTTATTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198137
CATSPER4 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-720s1c1
Sequence:CCGGGCCCAAGCATTTCCAGAACATCTCGAGATGTTCTGGAAATGCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-633s1c1
Sequence:CCGGGCCTGACATGGCCAATATCATCTCGAGATGATATTGGCCATGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-190s1c1
Sequence:CCGGCGCCAGGAAATCACGAACAAACTCGAGTTTGTTCGTGATTTCCTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-138s1c1
Sequence:CCGGGAGTACCATTCACGAGTCCTACTCGAGTAGGACTCGTGAATGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-753s1c1
Sequence:CCGGGTACACCCTCTTCATCTGCATCTCGAGATGCAGATGAAGAGGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-687s1c1
Sequence:CCGGCGTGTTTGGAGTAACACTCTTCTCGAGAAGAGTGTTACTCCAAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-465s1c1
Sequence:CCGGCTGGAACATCCTCAACTTCATCTCGAGATGAAGTTGAGGATGTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-354s1c1
Sequence:CCGGCCAGAAACACTATGAGTTGTTCTCGAGAACAACTCATAGTGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-1182s1c1
Sequence:CCGGCCGAGATGAACTCAACATGATCTCGAGATCATGTTGAGTTCATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-970s1c1
Sequence:CCGGCGAATAACCTTTAGTGAGACACTCGAGTGTCTCACTAAAGGTTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-858s1c1
Sequence:CCGGCTTTACCATCTTCATCACCATCTCGAGATGGTGATGAAGATGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-966s1c1
Sequence:CCGGGCAACGAATAACCTTTAGTGACTCGAGTCACTAAAGGTTATTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198137
CATSPER4 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-720s1c1
Sequence:CCGGGCCCAAGCATTTCCAGAACATCTCGAGATGTTCTGGAAATGCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-633s1c1
Sequence:CCGGGCCTGACATGGCCAATATCATCTCGAGATGATATTGGCCATGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-190s1c1
Sequence:CCGGCGCCAGGAAATCACGAACAAACTCGAGTTTGTTCGTGATTTCCTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-138s1c1
Sequence:CCGGGAGTACCATTCACGAGTCCTACTCGAGTAGGACTCGTGAATGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-753s1c1
Sequence:CCGGGTACACCCTCTTCATCTGCATCTCGAGATGCAGATGAAGAGGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-687s1c1
Sequence:CCGGCGTGTTTGGAGTAACACTCTTCTCGAGAAGAGTGTTACTCCAAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-465s1c1
Sequence:CCGGCTGGAACATCCTCAACTTCATCTCGAGATGAAGTTGAGGATGTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-354s1c1
Sequence:CCGGCCAGAAACACTATGAGTTGTTCTCGAGAACAACTCATAGTGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198137.1-1182s1c1
Sequence:CCGGCCGAGATGAACTCAACATGATCTCGAGATCATGTTGAGTTCATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-970s1c1
Sequence:CCGGCGAATAACCTTTAGTGAGACACTCGAGTGTCTCACTAAAGGTTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-858s1c1
Sequence:CCGGCTTTACCATCTTCATCACCATCTCGAGATGGTGATGAAGATGGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198137.1-966s1c1
Sequence:CCGGGCAACGAATAACCTTTAGTGACTCGAGTCACTAAAGGTTATTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177866
CATSPER4 MISSION shRNA Bacterial Glycerol Stock
cation channel, sperm associated 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-1052s1c1
Sequence:CCGGCCCTGAGTAACCTCACAGAAACTCGAGTTTCTGTGAGGTTACTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-750s1c1
Sequence:CCGGGCTGGACATCTACACTGACTTCTCGAGAAGTCAGTGTAGATGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-276s21c1
Sequence:CCGGTGCTGCTGTCCAACGCTATCACTCGAGTGATAGCGTTGGACAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-363s21c1
Sequence:CCGGACATTGTGTTGACGATCCTTACTCGAGTAAGGATCGTCAACACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-574s1c1
Sequence:CCGGGGCCAGAATCATCAAGGTTATCTCGAGATAACCTTGATGATTCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-329s1c1
Sequence:CCGGCAGAAACATTACGAGCTATTCCTCGAGGAATAGCTCGTAATGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-302s21c1
Sequence:CCGGGCCCTTCGCACCAACTCTTATCTCGAGATAAGAGTTGGTGCGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-183s21c1
Sequence:CCGGAGAAGGATGCCTGGGATGTACCTCGAGGTACATCCCAGGCATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-328s21c1
Sequence:CCGGTCAGAAACATTACGAGCTATTCTCGAGAATAGCTCGTAATGTTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177866
CATSPER4 MISSION shRNA shRNA Plasmid DNA
cation channel, sperm associated 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-1052s1c1
Sequence:CCGGCCCTGAGTAACCTCACAGAAACTCGAGTTTCTGTGAGGTTACTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-750s1c1
Sequence:CCGGGCTGGACATCTACACTGACTTCTCGAGAAGTCAGTGTAGATGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-276s21c1
Sequence:CCGGTGCTGCTGTCCAACGCTATCACTCGAGTGATAGCGTTGGACAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-363s21c1
Sequence:CCGGACATTGTGTTGACGATCCTTACTCGAGTAAGGATCGTCAACACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-574s1c1
Sequence:CCGGGGCCAGAATCATCAAGGTTATCTCGAGATAACCTTGATGATTCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-329s1c1
Sequence:CCGGCAGAAACATTACGAGCTATTCCTCGAGGAATAGCTCGTAATGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-302s21c1
Sequence:CCGGGCCCTTCGCACCAACTCTTATCTCGAGATAAGAGTTGGTGCGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-183s21c1
Sequence:CCGGAGAAGGATGCCTGGGATGTACCTCGAGGTACATCCCAGGCATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-328s21c1
Sequence:CCGGTCAGAAACATTACGAGCTATTCTCGAGAATAGCTCGTAATGTTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177866
CATSPER4 MISSION shRNA Lentiviral Transduction Particles
cation channel, sperm associated 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-1052s1c1
Sequence:CCGGCCCTGAGTAACCTCACAGAAACTCGAGTTTCTGTGAGGTTACTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.2-750s1c1
Sequence:CCGGGCTGGACATCTACACTGACTTCTCGAGAAGTCAGTGTAGATGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-276s21c1
Sequence:CCGGTGCTGCTGTCCAACGCTATCACTCGAGTGATAGCGTTGGACAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-363s21c1
Sequence:CCGGACATTGTGTTGACGATCCTTACTCGAGTAAGGATCGTCAACACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-574s1c1
Sequence:CCGGGGCCAGAATCATCAAGGTTATCTCGAGATAACCTTGATGATTCTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177866.4-329s1c1
Sequence:CCGGCAGAAACATTACGAGCTATTCCTCGAGGAATAGCTCGTAATGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-302s21c1
Sequence:CCGGGCCCTTCGCACCAACTCTTATCTCGAGATAAGAGTTGGTGCGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-183s21c1
Sequence:CCGGAGAAGGATGCCTGGGATGTACCTCGAGGTACATCCCAGGCATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177866.4-328s21c1
Sequence:CCGGTCAGAAACATTACGAGCTATTCTCGAGAATAGCTCGTAATGTTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)