EMAIL THIS PAGE TO A FRIEND

CATSPERB

catsper channel auxiliary subunit beta

38 Gene Product Result for
Synonyms: C14orf161 CatSper(beta)
UniProtKB ID: Q9H7T0, A0AV51
Gene ID:
Mouse(271036) catsper channel auxiliary subunit beta
domestic cat(101096074) catsper channel auxiliary subunit beta
cow(617124) catsper channel auxiliary subunit beta
dog(607178) catsper channel auxiliary subunit beta
Horse(100063296) catsper channel auxiliary subunit beta
domestic guinea pig(100736220) catsper channel auxiliary subunit beta
naked mole-rat(101710491) catsper channel auxiliary subunit beta
sheep(101112425) catsper channel auxiliary subunit beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024764 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032971 MISSION® esiRNA esiRNA human CATSPERB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024764 Rosetta Predictions human pricing
NM_173023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244464 predicted 1836
2 SASI_Hs01_00244466 predicted 703
3 SASI_Hs01_00244467 predicted 2630
4 SASI_Hs01_00244468 predicted 1058
5 SASI_Hs01_00244469 predicted 2855
6 SASI_Hs01_00244470 predicted 553
7 SASI_Hs02_00357269 predicted 663
8 SASI_Hs01_00244472 predicted 1909
9 SASI_Hs01_00244473 predicted 428
10 SASI_Hs02_00357270 predicted 577
11 SASI_Hs01_00244465 predicted 1247
12 SASI_Hs01_00244471 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197794 predicted 1428
2 SASI_Mm01_00197795 predicted 751
3 SASI_Mm01_00197796 predicted 553
4 SASI_Mm01_00197797 predicted 570
5 SASI_Mm01_00197798 predicted 2402
6 SASI_Mm01_00197799 predicted 1242
7 SASI_Mm01_00197800 predicted 2235
8 SASI_Mm01_00197801 predicted 1275
9 SASI_Mm01_00197802 predicted 3374
10 SASI_Mm01_00197803 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024764
CATSPERB MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3177s21c1
Sequence:CCGGGGTCTCAACTTAAGCATAAAGCTCGAGCTTTATGCTTAAGTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3214s21c1
Sequence:CCGGACTTTAGAGTGACCGTCATTTCTCGAGAAATGACGGTCACTCTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-1836s21c1
Sequence:CCGGAGCAAGAAGTTCGGCAATATACTCGAGTATATTGCCGAACTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1347s1c1
Sequence:CCGGGCAGATCCTAGCAAACCCATACTCGAGTATGGGTTTGCTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-501s1c1
Sequence:CCGGGCAGAAATGAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024764.1-2002s1c1
Sequence:CCGGGTGAGCTGATTCATAGATCAACTCGAGTTGATCTATGAATCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-624s1c1
Sequence:CCGGGCCTTGTTTGAAGATACAGATCTCGAGATCTGTATCTTCAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1190s1c1
Sequence:CCGGGCATCACATTCCTAGCAAATTCTCGAGAATTTGCTAGGAATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1087s1c1
Sequence:CCGGGTTCAACTTCACTGGCATTTACTCGAGTAAATGCCAGTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024764
CATSPERB MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3177s21c1
Sequence:CCGGGGTCTCAACTTAAGCATAAAGCTCGAGCTTTATGCTTAAGTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3214s21c1
Sequence:CCGGACTTTAGAGTGACCGTCATTTCTCGAGAAATGACGGTCACTCTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-1836s21c1
Sequence:CCGGAGCAAGAAGTTCGGCAATATACTCGAGTATATTGCCGAACTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1347s1c1
Sequence:CCGGGCAGATCCTAGCAAACCCATACTCGAGTATGGGTTTGCTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-501s1c1
Sequence:CCGGGCAGAAATGAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024764.1-2002s1c1
Sequence:CCGGGTGAGCTGATTCATAGATCAACTCGAGTTGATCTATGAATCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-624s1c1
Sequence:CCGGGCCTTGTTTGAAGATACAGATCTCGAGATCTGTATCTTCAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1190s1c1
Sequence:CCGGGCATCACATTCCTAGCAAATTCTCGAGAATTTGCTAGGAATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1087s1c1
Sequence:CCGGGTTCAACTTCACTGGCATTTACTCGAGTAAATGCCAGTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024764
CATSPERB MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3177s21c1
Sequence:CCGGGGTCTCAACTTAAGCATAAAGCTCGAGCTTTATGCTTAAGTTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-3214s21c1
Sequence:CCGGACTTTAGAGTGACCGTCATTTCTCGAGAAATGACGGTCACTCTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024764.2-1836s21c1
Sequence:CCGGAGCAAGAAGTTCGGCAATATACTCGAGTATATTGCCGAACTTCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1347s1c1
Sequence:CCGGGCAGATCCTAGCAAACCCATACTCGAGTATGGGTTTGCTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-501s1c1
Sequence:CCGGGCAGAAATGAAAGAGCCCTTTCTCGAGAAAGGGCTCTTTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024764.1-2002s1c1
Sequence:CCGGGTGAGCTGATTCATAGATCAACTCGAGTTGATCTATGAATCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-624s1c1
Sequence:CCGGGCCTTGTTTGAAGATACAGATCTCGAGATCTGTATCTTCAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1190s1c1
Sequence:CCGGGCATCACATTCCTAGCAAATTCTCGAGAATTTGCTAGGAATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024764.1-1087s1c1
Sequence:CCGGGTTCAACTTCACTGGCATTTACTCGAGTAAATGCCAGTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173023
CATSPERB MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-2251s1c1
Sequence:CCGGGCATAAGTACAAGACAATGTACTCGAGTACATTGTCTTGTACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3486s1c1
Sequence:CCGGCCTAGTTCCATTAAACATGTTCTCGAGAACATGTTTAATGGAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3478s1c1
Sequence:CCGGCTTTGAATCCTAGTTCCATTACTCGAGTAATGGAACTAGGATTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-678s1c1
Sequence:CCGGGCCAATGATGTGGCTTTAATACTCGAGTATTAAAGCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-1391s1c1
Sequence:CCGGCAGTCAAATATGGGTTTCAATCTCGAGATTGAAACCCATATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173023
CATSPERB MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-2251s1c1
Sequence:CCGGGCATAAGTACAAGACAATGTACTCGAGTACATTGTCTTGTACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3486s1c1
Sequence:CCGGCCTAGTTCCATTAAACATGTTCTCGAGAACATGTTTAATGGAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3478s1c1
Sequence:CCGGCTTTGAATCCTAGTTCCATTACTCGAGTAATGGAACTAGGATTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-678s1c1
Sequence:CCGGGCCAATGATGTGGCTTTAATACTCGAGTATTAAAGCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-1391s1c1
Sequence:CCGGCAGTCAAATATGGGTTTCAATCTCGAGATTGAAACCCATATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173023
CATSPERB MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-2251s1c1
Sequence:CCGGGCATAAGTACAAGACAATGTACTCGAGTACATTGTCTTGTACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3486s1c1
Sequence:CCGGCCTAGTTCCATTAAACATGTTCTCGAGAACATGTTTAATGGAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173023.1-3478s1c1
Sequence:CCGGCTTTGAATCCTAGTTCCATTACTCGAGTAATGGAACTAGGATTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-678s1c1
Sequence:CCGGGCCAATGATGTGGCTTTAATACTCGAGTATTAAAGCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173023.1-1391s1c1
Sequence:CCGGCAGTCAAATATGGGTTTCAATCTCGAGATTGAAACCCATATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks