EMAIL THIS PAGE TO A FRIEND

CATSPERD

catsper channel auxiliary subunit delta

64 Gene Product Result for
Synonyms: TMEM146
UniProtKB ID: Q86XM0, Q6ZRP1
Gene ID:
Mouse(106757) catsper channel auxiliary subunit delta
Rat(680264) catsper channel auxiliary subunit delta
sheep(101111283) catsper channel auxiliary subunit delta
naked mole-rat(101714963) catsper channel auxiliary subunit delta
domestic cat(101084426) catsper channel auxiliary subunit delta
cow(617472) transmembrane protein 146
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001052081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001052081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001052081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152784 Rosetta Predictions human pricing
NM_001134984 Rosetta Predictions rat pricing
XM_001052081 Rosetta Predictions mouse pricing
XM_001052082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229849 predicted 745
2 SASI_Hs01_00229850 predicted 615
3 SASI_Hs01_00229851 predicted 1467
4 SASI_Hs01_00229852 predicted 1395
5 SASI_Hs01_00229853 predicted 202
6 SASI_Hs01_00229854 predicted 1286
7 SASI_Hs01_00229855 predicted 1387
8 SASI_Hs01_00229857 predicted 1901
9 SASI_Hs02_00366726 predicted 345
10 SASI_Hs02_00366727 predicted 282
11 SASI_Hs01_00229848 predicted 1261
12 SASI_Hs01_00229856 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259244 predicted 1099
2 SASI_Rn02_00259245 predicted 586
3 SASI_Rn02_00259246 predicted 1906
4 SASI_Rn02_00259247 predicted 877
5 SASI_Rn02_00259248 predicted 819
6 SASI_Rn02_00259249 predicted 963
7 SASI_Rn02_00259250 predicted 2080
8 SASI_Rn02_00259251 predicted 220
9 SASI_Rn02_00259252 predicted 2026
10 SASI_Rn02_00259253 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356567 predicted 924
2 SASI_Mm02_00356568 predicted 1169
3 SASI_Mm02_00356569 predicted 745
4 SASI_Mm02_00356570 predicted 1179
5 SASI_Mm02_00356571 predicted 1069
6 SASI_Mm02_00356572 predicted 945
7 SASI_Mm02_00356573 predicted 393
8 SASI_Mm02_00356574 predicted 758
9 SASI_Mm02_00356575 predicted 766
10 SASI_Mm02_00356576 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276137 predicted 1186
2 SASI_Mm02_00356577 predicted 1182
3 SASI_Mm02_00356578 predicted 1180
4 SASI_Mm02_00356579 predicted 1136
5 SASI_Mm01_00276139 predicted 1215
6 SASI_Mm01_00276140 predicted 1288
7 SASI_Mm01_00276141 predicted 1117
8 SASI_Mm02_00356580 predicted 1111
9 SASI_Mm01_00276142 predicted 1265
10 SASI_Mm02_00356581 predicted 1272
11 SASI_Mm01_00276135 predicted 1114
12 SASI_Mm01_00276136 predicted 1147
13 SASI_Mm01_00276138 predicted 1257
14 SASI_Mm01_00276143 predicted 1353
15 SASI_Mm01_00276144 predicted 1386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175350
VALIDATED
CATSPERD MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit delta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1383s1c1
Sequence:CCGGGCTACCAGATACTCCAGCTTTCTCGAGAAAGCTGGAGTATCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1149s1c1
Sequence:CCGGGCCAAAGAAATGGGATCTATACTCGAGTATAGATCCCATTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-899s1c1
Sequence:CCGGGAGTATGTCATCTCGGAGATACTCGAGTATCTCCGAGATGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-560s1c1
Sequence:CCGGGACATAGCTGACAAGACACTTCTCGAGAAGTGTCTTGTCAGCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-1030s1c1
Sequence:CCGGCCTCTGGAACAGAGAGAACTACTCGAGTAGTTCTCTCTGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-451s1c1
Sequence:CCGGCTCTAAGTACAAACTGGATATCTCGAGATATCCAGTTTGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-360s1c1
Sequence:CCGGCGCTTCAACCATGTAATGTCACTCGAGTGACATTACATGGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175350
VALIDATED
CATSPERD MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit delta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1383s1c1
Sequence:CCGGGCTACCAGATACTCCAGCTTTCTCGAGAAAGCTGGAGTATCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1149s1c1
Sequence:CCGGGCCAAAGAAATGGGATCTATACTCGAGTATAGATCCCATTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-899s1c1
Sequence:CCGGGAGTATGTCATCTCGGAGATACTCGAGTATCTCCGAGATGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-560s1c1
Sequence:CCGGGACATAGCTGACAAGACACTTCTCGAGAAGTGTCTTGTCAGCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-1030s1c1
Sequence:CCGGCCTCTGGAACAGAGAGAACTACTCGAGTAGTTCTCTCTGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-451s1c1
Sequence:CCGGCTCTAAGTACAAACTGGATATCTCGAGATATCCAGTTTGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-360s1c1
Sequence:CCGGCGCTTCAACCATGTAATGTCACTCGAGTGACATTACATGGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175350
VALIDATED
CATSPERD MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit delta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1383s1c1
Sequence:CCGGGCTACCAGATACTCCAGCTTTCTCGAGAAAGCTGGAGTATCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175350.2-1149s1c1
Sequence:CCGGGCCAAAGAAATGGGATCTATACTCGAGTATAGATCCCATTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-899s1c1
Sequence:CCGGGAGTATGTCATCTCGGAGATACTCGAGTATCTCCGAGATGACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175350.2-560s1c1
Sequence:CCGGGACATAGCTGACAAGACACTTCTCGAGAAGTGTCTTGTCAGCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-1030s1c1
Sequence:CCGGCCTCTGGAACAGAGAGAACTACTCGAGTAGTTCTCTCTGTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-451s1c1
Sequence:CCGGCTCTAAGTACAAACTGGATATCTCGAGATATCCAGTTTGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175350.2-360s1c1
Sequence:CCGGCGCTTCAACCATGTAATGTCACTCGAGTGACATTACATGGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152784
CATSPERD MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit delta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1271s1c1
Sequence:CCGGGCTGGAATTGACTGCTTCGTTCTCGAGAACGAAGCAGTCAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1193s1c1
Sequence:CCGGCCACGTTGGAAAGTGCAAGATCTCGAGATCTTGCACTTTCCAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-357s1c1
Sequence:CCGGGCTGGTTCGTTATTGCTGTTACTCGAGTAACAGCAATAACGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1649s1c1
Sequence:CCGGCCTGCAAGACAATTACAGCTTCTCGAGAAGCTGTAATTGTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-2082s21c1
Sequence:CCGGGGACAGCAAACCAGATCATTTCTCGAGAAATGATCTGGTTTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-439s21c1
Sequence:CCGGGAGCATGTCTTTAGGTATAAACTCGAGTTTATACCTAAAGACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-207s21c1
Sequence:CCGGCTACAACAACACGCTTGATTACTCGAGTAATCAAGCGTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-984s21c1
Sequence:CCGGTTATAACTCGGGAGGATAATTCTCGAGAATTATCCTCCCGAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152784
CATSPERD MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit delta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1271s1c1
Sequence:CCGGGCTGGAATTGACTGCTTCGTTCTCGAGAACGAAGCAGTCAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1193s1c1
Sequence:CCGGCCACGTTGGAAAGTGCAAGATCTCGAGATCTTGCACTTTCCAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-357s1c1
Sequence:CCGGGCTGGTTCGTTATTGCTGTTACTCGAGTAACAGCAATAACGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1649s1c1
Sequence:CCGGCCTGCAAGACAATTACAGCTTCTCGAGAAGCTGTAATTGTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-2082s21c1
Sequence:CCGGGGACAGCAAACCAGATCATTTCTCGAGAAATGATCTGGTTTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-439s21c1
Sequence:CCGGGAGCATGTCTTTAGGTATAAACTCGAGTTTATACCTAAAGACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-207s21c1
Sequence:CCGGCTACAACAACACGCTTGATTACTCGAGTAATCAAGCGTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-984s21c1
Sequence:CCGGTTATAACTCGGGAGGATAATTCTCGAGAATTATCCTCCCGAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152784
CATSPERD MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit delta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1271s1c1
Sequence:CCGGGCTGGAATTGACTGCTTCGTTCTCGAGAACGAAGCAGTCAATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1193s1c1
Sequence:CCGGCCACGTTGGAAAGTGCAAGATCTCGAGATCTTGCACTTTCCAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-357s1c1
Sequence:CCGGGCTGGTTCGTTATTGCTGTTACTCGAGTAACAGCAATAACGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152784.2-1649s1c1
Sequence:CCGGCCTGCAAGACAATTACAGCTTCTCGAGAAGCTGTAATTGTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-2082s21c1
Sequence:CCGGGGACAGCAAACCAGATCATTTCTCGAGAAATGATCTGGTTTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-439s21c1
Sequence:CCGGGAGCATGTCTTTAGGTATAAACTCGAGTTTATACCTAAAGACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-207s21c1
Sequence:CCGGCTACAACAACACGCTTGATTACTCGAGTAATCAAGCGTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152784.3-984s21c1
Sequence:CCGGTTATAACTCGGGAGGATAATTCTCGAGAATTATCCTCCCGAGTTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001052081
CATSPERD MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit delta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000216779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-431s1c1
Sequence:CCGGGGTTTAAGGCAAACCTCAATGCTCGAGCATTGAGGTTTGCCTTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1150s1c1
Sequence:CCGGCAGACAAACAACAAGATTATTCTCGAGAATAATCTTGTTGTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1233s1c1
Sequence:CCGGCTGCAACCTGAACACCATATTCTCGAGAATATGGTGTTCAGGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-795s1c1
Sequence:CCGGCCAGGATGACCTGATAGTATTCTCGAGAATACTATCAGGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001052081
CATSPERD MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit delta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000216779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-431s1c1
Sequence:CCGGGGTTTAAGGCAAACCTCAATGCTCGAGCATTGAGGTTTGCCTTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1150s1c1
Sequence:CCGGCAGACAAACAACAAGATTATTCTCGAGAATAATCTTGTTGTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1233s1c1
Sequence:CCGGCTGCAACCTGAACACCATATTCTCGAGAATATGGTGTTCAGGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-795s1c1
Sequence:CCGGCCAGGATGACCTGATAGTATTCTCGAGAATACTATCAGGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001052081
CATSPERD MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit delta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000216779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-431s1c1
Sequence:CCGGGGTTTAAGGCAAACCTCAATGCTCGAGCATTGAGGTTTGCCTTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1150s1c1
Sequence:CCGGCAGACAAACAACAAGATTATTCTCGAGAATAATCTTGTTGTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-1233s1c1
Sequence:CCGGCTGCAACCTGAACACCATATTCTCGAGAATATGGTGTTCAGGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052081.2-795s1c1
Sequence:CCGGCCAGGATGACCTGATAGTATTCTCGAGAATACTATCAGGTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks