EMAIL THIS PAGE TO A FRIEND

CATSPERG

catsper channel auxiliary subunit gamma

20 Gene Product Result for
Synonyms: C19orf15
UniProtKB ID: Q6ZRH7, A6NEG6, Q659E1
Gene ID:
Human(57828) Summary: CATSPERG is a subunit of the CATSPER (see CATSPER1; MIM 606389) sperm calcium channel, which is required for sperm hyperactivated motility and male fertility (Wang et al., 2009 [PubMed 19516020]
dog(484530) catsper channel auxiliary subunit gamma
cow(100141222) catsper channel auxiliary subunit gamma
domestic cat(101095704) catsper channel auxiliary subunit gamma
domestic guinea pig(100726738) catsper channel auxiliary subunit gamma
naked mole-rat(101725972) catsper channel auxiliary subunit gamma
sheep(101111312) catsper channel auxiliary subunit gamma
Domestic Rabbit(100350073) catsper channel auxiliary subunit gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021185 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071561 MISSION® esiRNA esiRNA human C19orf15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021185 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043330 predicted 1939
2 SASI_Hs01_00043331 predicted 1962
3 SASI_Hs01_00043333 predicted 1294
4 SASI_Hs01_00043334 predicted 2618
5 SASI_Hs02_00354755 predicted 1757
6 SASI_Hs01_00043335 predicted 1529
7 SASI_Hs01_00043337 predicted 2591
8 SASI_Hs01_00043338 predicted 3404
9 SASI_Hs01_00043339 predicted 3160
10 SASI_Hs02_00354756 predicted 1298
11 SASI_Hs01_00043332 predicted 2844
12 SASI_Hs01_00043336 predicted 1244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021185
CATSPERG MISSION shRNA Bacterial Glycerol Stock
catsper channel auxiliary subunit gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1266s21c1
Sequence:CCGGGTGCGAGCAGATAGGAGTTACCTCGAGGTAACTCCTATCTGCTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1354s21c1
Sequence:CCGGGGATATGGTAATGCAAGTAAACTCGAGTTTACTTGCATTACCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2799s21c1
Sequence:CCGGACACTACTTTGACTGCGTTAACTCGAGTTAACGCAGTCAAAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2970s21c1
Sequence:CCGGGGACTACAGTGAGGACGAAATCTCGAGATTTCGTCCTCACTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1728s1c1
Sequence:CCGGCACTATGACTTGGAGCGGAAACTCGAGTTTCCGCTCCAAGTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1544s1c1
Sequence:CCGGGCACATCAGCTTAAAGCTGATCTCGAGATCAGCTTTAAGCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-3176s1c1
Sequence:CCGGGTGGAAGATAAACAACCTCATCTCGAGATGAGGTTGTTTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2367s1c1
Sequence:CCGGCTTTGCTATGACCAAGGCATTCTCGAGAATGCCTTGGTCATAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021185.3-2075s1c1
Sequence:CCGGGTCCATAGAAATGGACAGCTACTCGAGTAGCTGTCCATTTCTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2383s1c1
Sequence:CCGGGCATTAGTGGACATCACCTTACTCGAGTAAGGTGATGTCCACTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021185
CATSPERG MISSION shRNA shRNA Plasmid DNA
catsper channel auxiliary subunit gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1266s21c1
Sequence:CCGGGTGCGAGCAGATAGGAGTTACCTCGAGGTAACTCCTATCTGCTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1354s21c1
Sequence:CCGGGGATATGGTAATGCAAGTAAACTCGAGTTTACTTGCATTACCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2799s21c1
Sequence:CCGGACACTACTTTGACTGCGTTAACTCGAGTTAACGCAGTCAAAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2970s21c1
Sequence:CCGGGGACTACAGTGAGGACGAAATCTCGAGATTTCGTCCTCACTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1728s1c1
Sequence:CCGGCACTATGACTTGGAGCGGAAACTCGAGTTTCCGCTCCAAGTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1544s1c1
Sequence:CCGGGCACATCAGCTTAAAGCTGATCTCGAGATCAGCTTTAAGCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-3176s1c1
Sequence:CCGGGTGGAAGATAAACAACCTCATCTCGAGATGAGGTTGTTTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2367s1c1
Sequence:CCGGCTTTGCTATGACCAAGGCATTCTCGAGAATGCCTTGGTCATAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021185.3-2075s1c1
Sequence:CCGGGTCCATAGAAATGGACAGCTACTCGAGTAGCTGTCCATTTCTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2383s1c1
Sequence:CCGGGCATTAGTGGACATCACCTTACTCGAGTAAGGTGATGTCCACTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021185
CATSPERG MISSION shRNA Lentiviral Transduction Particles
catsper channel auxiliary subunit gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1266s21c1
Sequence:CCGGGTGCGAGCAGATAGGAGTTACCTCGAGGTAACTCCTATCTGCTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-1354s21c1
Sequence:CCGGGGATATGGTAATGCAAGTAAACTCGAGTTTACTTGCATTACCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2799s21c1
Sequence:CCGGACACTACTTTGACTGCGTTAACTCGAGTTAACGCAGTCAAAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021185.4-2970s21c1
Sequence:CCGGGGACTACAGTGAGGACGAAATCTCGAGATTTCGTCCTCACTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1728s1c1
Sequence:CCGGCACTATGACTTGGAGCGGAAACTCGAGTTTCCGCTCCAAGTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-1544s1c1
Sequence:CCGGGCACATCAGCTTAAAGCTGATCTCGAGATCAGCTTTAAGCTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-3176s1c1
Sequence:CCGGGTGGAAGATAAACAACCTCATCTCGAGATGAGGTTGTTTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2367s1c1
Sequence:CCGGCTTTGCTATGACCAAGGCATTCTCGAGAATGCCTTGGTCATAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021185.3-2075s1c1
Sequence:CCGGGTCCATAGAAATGGACAGCTACTCGAGTAGCTGTCCATTTCTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021185.3-2383s1c1
Sequence:CCGGGCATTAGTGGACATCACCTTACTCGAGTAAGGTGATGTCCACTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks