EMAIL THIS PAGE TO A FRIEND

CAV2

caveolin 2

Synonyms: CAV
UniProtKB ID: P51636, A4D0U2, Q9UGM7
Gene ID:
Human(858) Summary: The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462). [provided by RefSeq, May 2011]
Mouse(12390) caveolin 2
Rat(363425) caveolin 2
sheep(100126571) caveolin 2
Zebrafish(415240) caveolin 2
cow(493642) caveolin 2
Horse(100071136) caveolin 2
dog(475294) caveolin 2
chicken(417772) caveolin 2
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001233 Rosetta Predictions human pricing
NM_198212 Rosetta Predictions human pricing
NM_131914 Rosetta Predictions rat pricing
NM_016900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059048 predicted 1106
2 SASI_Hs01_00059056 predicted 950
3 SASI_Hs01_00059049 predicted 1105
4 SASI_Hs01_00059051 predicted 1341
5 SASI_Hs02_00331405 predicted 1186
6 SASI_Hs01_00059053 predicted 1076
7 SASI_Hs01_00059050 predicted 951
8 SASI_Hs01_00059054 predicted 908
9 SASI_Hs01_00059055 predicted 681
10 SASI_Hs01_00059057 predicted 894
11 SASI_Hs01_00059052 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192488 predicted 915
2 SASI_Hs02_00371744 predicted 760
3 SASI_Hs01_00192489 predicted 919
4 SASI_Hs01_00192491 predicted 1156
5 SASI_Hs01_00192497 predicted 998
6 SASI_Hs01_00192493 predicted 891
7 SASI_Hs01_00192490 predicted 762
8 SASI_Hs01_00192494 predicted 719
9 SASI_Hs01_00192495 predicted 946
10 SASI_Hs01_00192496 predicted 712
11 SASI_Hs01_00192492 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054928 predicted 879
2 SASI_Rn01_00054929 predicted 717
3 SASI_Rn01_00054930 predicted 832
4 SASI_Rn02_00267547 predicted 199
5 SASI_Rn01_00054933 predicted 862
6 SASI_Rn01_00054934 predicted 804
7 SASI_Rn01_00054935 predicted 408
8 SASI_Rn01_00054936 predicted 619
9 SASI_Rn01_00054937 predicted 626
10 SASI_Rn02_00267548 predicted 678
11 SASI_Rn01_00054931 predicted 746
12 SASI_Rn01_00054932 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187906 predicted 892
2 SASI_Mm01_00187907 predicted 767
3 SASI_Mm01_00187909 predicted 829
4 SASI_Mm01_00187910 predicted 814
5 SASI_Mm01_00187911 predicted 731
6 SASI_Mm01_00187912 predicted 935
7 SASI_Mm01_00187913 predicted 680
8 SASI_Mm01_00187914 predicted 789
9 SASI_Mm01_00187915 predicted 437
10 SASI_Mm02_00323747 predicted 866
11 SASI_Mm01_00187908 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001233
VALIDATED
CAV2 MISSION shRNA Bacterial Glycerol Stock
caveolin 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-946s1c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-521s1c1
Sequence:CCGGCCGGCTCAACTCGCATCTCAACTCGAGTTGAGATGCGAGTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-779s1c1
Sequence:CCGGGCAGACAATATGGAAGAGTGTCTCGAGACACTCTTCCATATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-617s1c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-677s1c1
Sequence:CCGGCCTGGCCTTCATTGCGGGAATCTCGAGATTCCCGCAATGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-851s21c1
Sequence:GTACCGGTTCTGTCAGCCTGCAACTGAGCTCGAGCTCAGTTGCAGGCTGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-784s21c1
Sequence:GTACCGGCAATATGGAAGAGTGTGACAGCTCGAGCTGTCACACTCTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-429s21c1
Sequence:GTACCGGTTCATGGACGACGACTCCTACCTCGAGGTAGGAGTCGTCGTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-715s21c1
Sequence:GTACCGGGCTGTCTGCACATCTGGATTTCTCGAGAAATCCAGATGTGCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-946s21c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-864s21c1
Sequence:CCGGCAACTGAGCCAGGATTGAATACTCGAGTATTCAATCCTGGCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-617s21c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-577s21c1
Sequence:CCGGCTACGCACTCCTTTGACAAAGCTCGAGCTTTGTCAAAGGAGTGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-644s21c1
Sequence:GTACCGGGTACAAGTTCCTGACGGTGTTCTCGAGAACACCGTCAGGAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-827s21c1
Sequence:GTACCGGTACGAGCGTAGGACGATGCTTCTCGAGAAGCATCGTCCTACGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001233
VALIDATED
CAV2 MISSION shRNA shRNA Plasmid DNA
caveolin 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-946s1c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-521s1c1
Sequence:CCGGCCGGCTCAACTCGCATCTCAACTCGAGTTGAGATGCGAGTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-779s1c1
Sequence:CCGGGCAGACAATATGGAAGAGTGTCTCGAGACACTCTTCCATATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-617s1c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-677s1c1
Sequence:CCGGCCTGGCCTTCATTGCGGGAATCTCGAGATTCCCGCAATGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-851s21c1
Sequence:GTACCGGTTCTGTCAGCCTGCAACTGAGCTCGAGCTCAGTTGCAGGCTGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-784s21c1
Sequence:GTACCGGCAATATGGAAGAGTGTGACAGCTCGAGCTGTCACACTCTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-429s21c1
Sequence:GTACCGGTTCATGGACGACGACTCCTACCTCGAGGTAGGAGTCGTCGTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-715s21c1
Sequence:GTACCGGGCTGTCTGCACATCTGGATTTCTCGAGAAATCCAGATGTGCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-946s21c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-864s21c1
Sequence:CCGGCAACTGAGCCAGGATTGAATACTCGAGTATTCAATCCTGGCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-617s21c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-577s21c1
Sequence:CCGGCTACGCACTCCTTTGACAAAGCTCGAGCTTTGTCAAAGGAGTGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-644s21c1
Sequence:GTACCGGGTACAAGTTCCTGACGGTGTTCTCGAGAACACCGTCAGGAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-827s21c1
Sequence:GTACCGGTACGAGCGTAGGACGATGCTTCTCGAGAAGCATCGTCCTACGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001233
VALIDATED
CAV2 MISSION shRNA Lentiviral Transduction Particles
caveolin 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-946s1c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-521s1c1
Sequence:CCGGCCGGCTCAACTCGCATCTCAACTCGAGTTGAGATGCGAGTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-779s1c1
Sequence:CCGGGCAGACAATATGGAAGAGTGTCTCGAGACACTCTTCCATATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001233.3-617s1c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001233.3-677s1c1
Sequence:CCGGCCTGGCCTTCATTGCGGGAATCTCGAGATTCCCGCAATGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-851s21c1
Sequence:GTACCGGTTCTGTCAGCCTGCAACTGAGCTCGAGCTCAGTTGCAGGCTGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-784s21c1
Sequence:GTACCGGCAATATGGAAGAGTGTGACAGCTCGAGCTGTCACACTCTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-429s21c1
Sequence:GTACCGGTTCATGGACGACGACTCCTACCTCGAGGTAGGAGTCGTCGTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-715s21c1
Sequence:GTACCGGGCTGTCTGCACATCTGGATTTCTCGAGAAATCCAGATGTGCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-946s21c1
Sequence:CCGGGCACCACTGTTCTGTTCATTTCTCGAGAAATGAACAGAACAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-864s21c1
Sequence:CCGGCAACTGAGCCAGGATTGAATACTCGAGTATTCAATCCTGGCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001233.3-617s21c1
Sequence:CCGGCCTCTTTGAAATCAGCAAATACTCGAGTATTTGCTGATTTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-577s21c1
Sequence:CCGGCTACGCACTCCTTTGACAAAGCTCGAGCTTTGTCAAAGGAGTGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-644s21c1
Sequence:GTACCGGGTACAAGTTCCTGACGGTGTTCTCGAGAACACCGTCAGGAACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001233.3-827s21c1
Sequence:GTACCGGTACGAGCGTAGGACGATGCTTCTCGAGAAGCATCGTCCTACGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016900
VALIDATED
CAV2 MISSION shRNA Bacterial Glycerol Stock
caveolin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-102s1c1
Sequence:CCGGGCAGATCCTGAGAAGTATGTTCTCGAGAACATACTTCTCAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-95s1c1
Sequence:CCGGCGACTATGCAGATCCTGAGAACTCGAGTTCTCAGGATCTGCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-198s1c1
Sequence:CCGGCCTGAGACTACACACTCCTTTCTCGAGAAAGGAGTGTGTAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-243s1c1
Sequence:CCGGGCTCTCTTTGAAATCAGCAAACTCGAGTTTGCTGATTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016900.2-800s1c1
Sequence:CCGGCCTCAGACATTAGAGTAATTTCTCGAGAAATTACTCTAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016900
VALIDATED
CAV2 MISSION shRNA shRNA Plasmid DNA
caveolin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-102s1c1
Sequence:CCGGGCAGATCCTGAGAAGTATGTTCTCGAGAACATACTTCTCAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-95s1c1
Sequence:CCGGCGACTATGCAGATCCTGAGAACTCGAGTTCTCAGGATCTGCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-198s1c1
Sequence:CCGGCCTGAGACTACACACTCCTTTCTCGAGAAAGGAGTGTGTAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-243s1c1
Sequence:CCGGGCTCTCTTTGAAATCAGCAAACTCGAGTTTGCTGATTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016900.2-800s1c1
Sequence:CCGGCCTCAGACATTAGAGTAATTTCTCGAGAAATTACTCTAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016900
VALIDATED
CAV2 MISSION shRNA Lentiviral Transduction Particles
caveolin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-102s1c1
Sequence:CCGGGCAGATCCTGAGAAGTATGTTCTCGAGAACATACTTCTCAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-95s1c1
Sequence:CCGGCGACTATGCAGATCCTGAGAACTCGAGTTCTCAGGATCTGCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016900.2-198s1c1
Sequence:CCGGCCTGAGACTACACACTCCTTTCTCGAGAAAGGAGTGTGTAGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016900.2-243s1c1
Sequence:CCGGGCTCTCTTTGAAATCAGCAAACTCGAGTTTGCTGATTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016900.2-800s1c1
Sequence:CCGGCCTCAGACATTAGAGTAATTTCTCGAGAAATTACTCTAATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks