EMAIL THIS PAGE TO A FRIEND

CAV3

caveolin 3

64 Gene Product Result for
Synonyms: LGMD1C LQT9 VIP-21 VIP21
UniProtKB ID: P56539, A8K777, Q3T1A4
Gene ID:
Human(859) Summary: This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]
Mouse(12391) caveolin 3
Rat(29161) caveolin 3
Zebrafish(449679) caveolin 3
chicken(378796) caveolin 3
cow(615310) caveolin 3
dog(484671) caveolin 3
sheep(101107228) caveolin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063501 MISSION® esiRNA esiRNA human CAV3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001234 Rosetta Predictions human pricing
NM_033337 Rosetta Predictions human pricing
NM_019155 Rosetta Predictions rat pricing
NM_007617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195683 predicted 1012
2 SASI_Hs01_00195684 predicted 876
3 SASI_Hs01_00195685 predicted 1010
4 SASI_Hs01_00195686 predicted 784
5 SASI_Hs01_00195687 predicted 932
6 SASI_Hs01_00195688 predicted 1021
7 SASI_Hs01_00195689 predicted 219
8 SASI_Hs01_00195690 predicted 1011
9 SASI_Hs01_00195691 predicted 995
10 SASI_Hs01_00195692 predicted 72
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108661 predicted 974
2 SASI_Hs01_00108662 predicted 877
3 SASI_Hs01_00108663 predicted 222
4 SASI_Hs01_00108664 predicted 63
5 SASI_Hs01_00108665 predicted 168
6 SASI_Hs01_00108666 predicted 781
7 SASI_Hs01_00108667 predicted 602
8 SASI_Hs01_00108668 predicted 659
9 SASI_Hs01_00108669 predicted 776
10 SASI_Hs01_00108670 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116213 predicted 496
2 SASI_Rn01_00116214 predicted 975
3 SASI_Rn01_00116216 predicted 849
4 SASI_Rn01_00116217 predicted 868
5 SASI_Rn02_00261930 predicted 935
6 SASI_Rn01_00116218 predicted 826
7 SASI_Rn01_00116219 predicted 317
8 SASI_Rn02_00261931 predicted 481
9 SASI_Rn01_00116220 predicted 958
10 SASI_Rn01_00116221 predicted 759
11 SASI_Rn01_00116215 predicted 840
12 SASI_Rn01_00116222 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185284 predicted 721
2 SASI_Mm01_00185285 predicted 680
3 SASI_Mm01_00185286 predicted 320
4 SASI_Mm01_00185287 predicted 418
5 SASI_Mm01_00185288 predicted 464
6 SASI_Mm01_00185289 predicted 634
7 SASI_Mm01_00185290 predicted 468
8 SASI_Mm01_00185291 predicted 333
9 SASI_Mm01_00185292 predicted 528
10 SASI_Mm02_00312071 predicted 877
11 SASI_Mm01_00185293 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001234
VALIDATED
CAV3 MISSION shRNA Bacterial Glycerol Stock
caveolin 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-416s21c1
Sequence:GTACCGGATCAGCCACATCTACTCACTCCTCGAGGAGTGAGTAGATGTGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-348s21c1
Sequence:GTACCGGGCATCTCCTTCTGCCACATCTCTCGAGAGATGTGGCAGAAGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-1023s21c1
Sequence:GTACCGGACGTTCCTTGGAAGATCATGTCTCGAGACATGATCTTCCAAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-169s21c1
Sequence:GTACCGGGGACATAGTCAAGGTGGATTTCTCGAGAAATCCACCTTGACTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-275s21c1
Sequence:GTACCGGTACTGGTGCTACCGTCTGTTGCTCGAGCAACAGACGGTAGCACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-803s21c1
Sequence:GTACCGGAGGAAGGTGGCTCCAGTAAAGCTCGAGCTTTACTGGAGCCACCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-944s21c1
Sequence:GTACCGGTGTCTCTTCACTTGGCCAAATCTCGAGATTTGGCCAAGTGAAGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-250s21c1
Sequence:GTACCGGCTACACCACCTTCACTGTCTCCTCGAGGAGACAGTGAAGGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-504s21c1
Sequence:GTACCGGTGCTGCGGAAGGAGGTCTAAACTCGAGTTTAGACCTCCTTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001234.3-703s1c1
Sequence:CCGGCGTTCACTTGTACTGTAACAACTCGAGTTGTTACAGTACAAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-153s1c1
Sequence:CCGGCCAAGAACATTAACGAGGACACTCGAGTGTCCTCGTTAATGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001234.3-106s1c1
Sequence:CCGGCGTCAAGGATATCCACTGCAACTCGAGTTGCAGTGGATATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-421s1c1
Sequence:CCGGCCACATCTACTCACTCTGCATCTCGAGATGCAGAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-154s1c1
Sequence:CCGGCAAGAACATTAACGAGGACATCTCGAGATGTCCTCGTTAATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001234
VALIDATED
CAV3 MISSION shRNA shRNA Plasmid DNA
caveolin 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-416s21c1
Sequence:GTACCGGATCAGCCACATCTACTCACTCCTCGAGGAGTGAGTAGATGTGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-348s21c1
Sequence:GTACCGGGCATCTCCTTCTGCCACATCTCTCGAGAGATGTGGCAGAAGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-1023s21c1
Sequence:GTACCGGACGTTCCTTGGAAGATCATGTCTCGAGACATGATCTTCCAAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-169s21c1
Sequence:GTACCGGGGACATAGTCAAGGTGGATTTCTCGAGAAATCCACCTTGACTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-275s21c1
Sequence:GTACCGGTACTGGTGCTACCGTCTGTTGCTCGAGCAACAGACGGTAGCACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-803s21c1
Sequence:GTACCGGAGGAAGGTGGCTCCAGTAAAGCTCGAGCTTTACTGGAGCCACCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-944s21c1
Sequence:GTACCGGTGTCTCTTCACTTGGCCAAATCTCGAGATTTGGCCAAGTGAAGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-250s21c1
Sequence:GTACCGGCTACACCACCTTCACTGTCTCCTCGAGGAGACAGTGAAGGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-504s21c1
Sequence:GTACCGGTGCTGCGGAAGGAGGTCTAAACTCGAGTTTAGACCTCCTTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001234.3-703s1c1
Sequence:CCGGCGTTCACTTGTACTGTAACAACTCGAGTTGTTACAGTACAAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-153s1c1
Sequence:CCGGCCAAGAACATTAACGAGGACACTCGAGTGTCCTCGTTAATGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001234.3-106s1c1
Sequence:CCGGCGTCAAGGATATCCACTGCAACTCGAGTTGCAGTGGATATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-421s1c1
Sequence:CCGGCCACATCTACTCACTCTGCATCTCGAGATGCAGAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-154s1c1
Sequence:CCGGCAAGAACATTAACGAGGACATCTCGAGATGTCCTCGTTAATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001234
VALIDATED
CAV3 MISSION shRNA Lentiviral Transduction Particles
caveolin 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-416s21c1
Sequence:GTACCGGATCAGCCACATCTACTCACTCCTCGAGGAGTGAGTAGATGTGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-348s21c1
Sequence:GTACCGGGCATCTCCTTCTGCCACATCTCTCGAGAGATGTGGCAGAAGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-1023s21c1
Sequence:GTACCGGACGTTCCTTGGAAGATCATGTCTCGAGACATGATCTTCCAAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-169s21c1
Sequence:GTACCGGGGACATAGTCAAGGTGGATTTCTCGAGAAATCCACCTTGACTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-275s21c1
Sequence:GTACCGGTACTGGTGCTACCGTCTGTTGCTCGAGCAACAGACGGTAGCACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-803s21c1
Sequence:GTACCGGAGGAAGGTGGCTCCAGTAAAGCTCGAGCTTTACTGGAGCCACCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001234.3-944s21c1
Sequence:GTACCGGTGTCTCTTCACTTGGCCAAATCTCGAGATTTGGCCAAGTGAAGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-250s21c1
Sequence:GTACCGGCTACACCACCTTCACTGTCTCCTCGAGGAGACAGTGAAGGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001234.3-504s21c1
Sequence:GTACCGGTGCTGCGGAAGGAGGTCTAAACTCGAGTTTAGACCTCCTTCCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001234.3-703s1c1
Sequence:CCGGCGTTCACTTGTACTGTAACAACTCGAGTTGTTACAGTACAAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-153s1c1
Sequence:CCGGCCAAGAACATTAACGAGGACACTCGAGTGTCCTCGTTAATGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001234.3-106s1c1
Sequence:CCGGCGTCAAGGATATCCACTGCAACTCGAGTTGCAGTGGATATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-421s1c1
Sequence:CCGGCCACATCTACTCACTCTGCATCTCGAGATGCAGAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001234.3-154s1c1
Sequence:CCGGCAAGAACATTAACGAGGACATCTCGAGATGTCCTCGTTAATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007617
CAV3 MISSION shRNA Bacterial Glycerol Stock
caveolin 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-638s21c1
Sequence:GTACCGGTAAGAGCTACCTGATCGAGATCTCGAGATCTCGATCAGGTAGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-419s21c1
Sequence:GTACCGGGGACATTGTGAAGGTAGATTTCTCGAGAAATCTACCTTCACAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-581s21c1
Sequence:GTACCGGGGGATTCCTGTTCGCCTGTATCTCGAGATACAGGCGAACAGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-727s21c1
Sequence:GTACCGGGCCAGGTCTGCAGCAACATTACTCGAGTAATGTTGCTGCAGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-754s21c1
Sequence:GTACCGGTGCTGCGAAGGGAAGGCTAAACTCGAGTTTAGCCTTCCCTTCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007617.2-1047s1c1
Sequence:CCGGGCGTTCACATGTACTGTAATACTCGAGTATTACAGTACATGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-417s1c1
Sequence:CCGGGAGGACATTGTGAAGGTAGATCTCGAGATCTACCTTCACAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-363s1c1
Sequence:CCGGGACATTCACTGCAAGGAGATACTCGAGTATCTCCTTGCAGTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-671s1c1
Sequence:CCGGCCACATCTACTCACTGTGTATCTCGAGATACACAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-348s1c1
Sequence:CCGGGCTCGGATCATCAAGGACATTCTCGAGAATGTCCTTGATGATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007617
CAV3 MISSION shRNA shRNA Plasmid DNA
caveolin 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-638s21c1
Sequence:GTACCGGTAAGAGCTACCTGATCGAGATCTCGAGATCTCGATCAGGTAGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-419s21c1
Sequence:GTACCGGGGACATTGTGAAGGTAGATTTCTCGAGAAATCTACCTTCACAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-581s21c1
Sequence:GTACCGGGGGATTCCTGTTCGCCTGTATCTCGAGATACAGGCGAACAGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-727s21c1
Sequence:GTACCGGGCCAGGTCTGCAGCAACATTACTCGAGTAATGTTGCTGCAGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-754s21c1
Sequence:GTACCGGTGCTGCGAAGGGAAGGCTAAACTCGAGTTTAGCCTTCCCTTCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007617.2-1047s1c1
Sequence:CCGGGCGTTCACATGTACTGTAATACTCGAGTATTACAGTACATGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-417s1c1
Sequence:CCGGGAGGACATTGTGAAGGTAGATCTCGAGATCTACCTTCACAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-363s1c1
Sequence:CCGGGACATTCACTGCAAGGAGATACTCGAGTATCTCCTTGCAGTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-671s1c1
Sequence:CCGGCCACATCTACTCACTGTGTATCTCGAGATACACAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-348s1c1
Sequence:CCGGGCTCGGATCATCAAGGACATTCTCGAGAATGTCCTTGATGATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007617
CAV3 MISSION shRNA Lentiviral Transduction Particles
caveolin 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-638s21c1
Sequence:GTACCGGTAAGAGCTACCTGATCGAGATCTCGAGATCTCGATCAGGTAGCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-419s21c1
Sequence:GTACCGGGGACATTGTGAAGGTAGATTTCTCGAGAAATCTACCTTCACAATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-581s21c1
Sequence:GTACCGGGGGATTCCTGTTCGCCTGTATCTCGAGATACAGGCGAACAGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-727s21c1
Sequence:GTACCGGGCCAGGTCTGCAGCAACATTACTCGAGTAATGTTGCTGCAGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007617.2-754s21c1
Sequence:GTACCGGTGCTGCGAAGGGAAGGCTAAACTCGAGTTTAGCCTTCCCTTCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007617.2-1047s1c1
Sequence:CCGGGCGTTCACATGTACTGTAATACTCGAGTATTACAGTACATGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-417s1c1
Sequence:CCGGGAGGACATTGTGAAGGTAGATCTCGAGATCTACCTTCACAATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-363s1c1
Sequence:CCGGGACATTCACTGCAAGGAGATACTCGAGTATCTCCTTGCAGTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-671s1c1
Sequence:CCGGCCACATCTACTCACTGTGTATCTCGAGATACACAGTGAGTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007617.2-348s1c1
Sequence:CCGGGCTCGGATCATCAAGGACATTCTCGAGAATGTCCTTGATGATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks