EMAIL THIS PAGE TO A FRIEND

CBFA2T2

core-binding factor, runt domain, alpha subunit 2; translocated to, 2

349 Gene Product Result for
Synonyms: EHT MTGR1 ZMYND3 p85
Gene ID:
Human(9139) Summary: In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
Mouse(12396) core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
Rat(296293) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Zebrafish(100151413) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
chicken(419155) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
dog(477196) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
cow(527740) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Horse(100069109) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
domestic cat(101090759) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
sheep(101110436) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Domestic Rabbit(100357211) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
domestic guinea pig(100729254) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
naked mole-rat(101719942) core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101005 Anti-CBFA2T2 (271-285) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1101006 Anti-CBFA2T2 (446-460) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1400337 Anti-CBFA2T2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2100346 Anti-CBFA2T2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2105027 Anti-CBFA2T2 antibody produced in rabbit affinity isolated antibody horse, rabbit, guinea pig, human
western blot pricing
HPA060523 Anti-CBFA2T2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2106411 Anti-CBFA2T2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, horse
ELISA, western blot pricing
HPA072433 Anti-CBFA2T2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
AV37525 Anti-CBFA2T2H antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rabbit, human, rat
western blot pricing
SAB1404679 Monoclonal Anti-CBFA2T2 antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1402452 Monoclonal Anti-CBFA2T2 antibody produced in mouse clone 3A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005093 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146381 MISSION® esiRNA esiRNA human CBFA2T2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032999 Rosetta Predictions human pricing
NM_001039709 Rosetta Predictions human pricing
NM_005093 Rosetta Predictions human pricing
XM_001064983 Rosetta Predictions rat pricing
XM_215882 Rosetta Predictions rat pricing
NM_009823 Rosetta Predictions mouse pricing
NM_172860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180165 predicted 1034
2 SASI_Hs01_00180166 predicted 1080
3 SASI_Hs01_00180167 predicted 1355
4 SASI_Hs01_00180168 predicted 994
5 SASI_Hs01_00180169 predicted 989
6 SASI_Hs01_00180170 predicted 1742
7 SASI_Hs01_00180171 predicted 1111
8 SASI_Hs01_00180172 predicted 1070
9 SASI_Hs01_00180173 predicted 1048
10 SASI_Hs01_00180174 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070091 predicted 1162
2 SASI_Hs01_00070092 predicted 1206
3 SASI_Hs01_00070093 predicted 1480
4 SASI_Hs01_00070094 predicted 1126
5 SASI_Hs01_00070095 predicted 1118
6 SASI_Hs01_00070096 predicted 1879
7 SASI_Hs01_00070097 predicted 1243
8 SASI_Hs01_00070098 predicted 1193
9 SASI_Hs01_00070099 predicted 1176
10 SASI_Hs01_00070100 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180427 predicted 1454
2 SASI_Hs01_00180428 predicted 1499
3 SASI_Hs01_00180429 predicted 1767
4 SASI_Hs01_00180430 predicted 1411
5 SASI_Hs01_00180431 predicted 1409
6 SASI_Hs01_00180432 predicted 2162
7 SASI_Hs01_00180433 predicted 1533
8 SASI_Hs01_00180434 predicted 1485
9 SASI_Hs01_00180435 predicted 1458
10 SASI_Hs01_00180436 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312470 predicted 1375
2 SASI_Rn02_00312471 predicted 1325
3 SASI_Rn02_00312472 predicted 1121
4 SASI_Rn02_00312473 predicted 1325
5 SASI_Rn02_00312474 predicted 1380
6 SASI_Rn02_00312475 predicted 1334
7 SASI_Rn02_00312476 predicted 1990
8 SASI_Rn02_00312477 predicted 757
9 SASI_Rn02_00312478 predicted 1409
10 SASI_Rn02_00312479 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376294 predicted 1365
2 SASI_Rn02_00376295 predicted 1311
3 SASI_Rn02_00376296 predicted 1115
4 SASI_Rn02_00376297 predicted 1318
5 SASI_Rn02_00376298 predicted 1368
6 SASI_Rn02_00376299 predicted 1330
7 SASI_Rn02_00376300 predicted 1139
8 SASI_Rn02_00376301 predicted 752
9 SASI_Rn02_00376302 predicted 1395
10 SASI_Rn02_00376303 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317136 predicted 600
2 SASI_Mm02_00317137 predicted 533
3 SASI_Mm02_00317138 predicted 1959
4 SASI_Mm02_00317139 predicted 1150
5 SASI_Mm02_00317140 predicted 1154
6 SASI_Mm02_00317141 predicted 1054
7 SASI_Mm02_00317142 predicted 515
8 SASI_Mm02_00317143 predicted 506
9 SASI_Mm02_00317144 predicted 1872
10 SASI_Mm02_00317145 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344811 predicted 598
2 SASI_Mm02_00344812 predicted 534
3 SASI_Mm02_00344813 predicted 1967
4 SASI_Mm02_00344814 predicted 1146
5 SASI_Mm02_00344815 predicted 1157
6 SASI_Mm02_00344816 predicted 1054
7 SASI_Mm02_00344817 predicted 524
8 SASI_Mm02_00344818 predicted 499
9 SASI_Mm02_00344819 predicted 1874
10 SASI_Mm02_00344820 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172860
VALIDATED
CBFA2T2 MISSION shRNA Bacterial Glycerol Stock
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-2383s1c1
Sequence:CCGGGCTGTTAAGATGCTCAGAAATCTCGAGATTTCTGAGCATCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-934s1c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-1484s1c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-569s1c1
Sequence:CCGGCGTCCATTTGTGATTCCATTTCTCGAGAAATGGAATCACAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-1018s1c1
Sequence:CCGGGCACCACAATCTTAGTCTCAACTCGAGTTGAGACTAAGATTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-968s21c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1228s21c1
Sequence:CCGGACCGTGAAGAACTCAACTATTCTCGAGAATAGTTGAGTTCTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172860.2-1885s21c1
Sequence:CCGGTTGATGCCAACGGGCTCTAAGCTCGAGCTTAGAGCCCGTTGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1518s21c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1955s21c1
Sequence:CCGGCACCAGTGAGCTGGCTATTAGCTCGAGCTAATAGCCAGCTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172860
VALIDATED
CBFA2T2 MISSION shRNA shRNA Plasmid DNA
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-2383s1c1
Sequence:CCGGGCTGTTAAGATGCTCAGAAATCTCGAGATTTCTGAGCATCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-934s1c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-1484s1c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-569s1c1
Sequence:CCGGCGTCCATTTGTGATTCCATTTCTCGAGAAATGGAATCACAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-1018s1c1
Sequence:CCGGGCACCACAATCTTAGTCTCAACTCGAGTTGAGACTAAGATTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-968s21c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1228s21c1
Sequence:CCGGACCGTGAAGAACTCAACTATTCTCGAGAATAGTTGAGTTCTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172860.2-1885s21c1
Sequence:CCGGTTGATGCCAACGGGCTCTAAGCTCGAGCTTAGAGCCCGTTGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1518s21c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1955s21c1
Sequence:CCGGCACCAGTGAGCTGGCTATTAGCTCGAGCTAATAGCCAGCTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172860
VALIDATED
CBFA2T2 MISSION shRNA Lentiviral Transduction Particles
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-2383s1c1
Sequence:CCGGGCTGTTAAGATGCTCAGAAATCTCGAGATTTCTGAGCATCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-934s1c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172860.1-1484s1c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-569s1c1
Sequence:CCGGCGTCCATTTGTGATTCCATTTCTCGAGAAATGGAATCACAAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172860.1-1018s1c1
Sequence:CCGGGCACCACAATCTTAGTCTCAACTCGAGTTGAGACTAAGATTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-968s21c1
Sequence:CCGGGCACTATACACTAGAAGACATCTCGAGATGTCTTCTAGTGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1228s21c1
Sequence:CCGGACCGTGAAGAACTCAACTATTCTCGAGAATAGTTGAGTTCTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172860.2-1885s21c1
Sequence:CCGGTTGATGCCAACGGGCTCTAAGCTCGAGCTTAGAGCCCGTTGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1518s21c1
Sequence:CCGGGCTCGAATGGAGCAGACCATACTCGAGTATGGTCTGCTCCATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172860.2-1955s21c1
Sequence:CCGGCACCAGTGAGCTGGCTATTAGCTCGAGCTAATAGCCAGCTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005093
CBFA2T2 MISSION shRNA Bacterial Glycerol Stock
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005093.2-3657s1c1
Sequence:CCGGCCCACATTCTTCCCTGTCTTTCTCGAGAAAGACAGGGAAGAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1444s1c1
Sequence:CCGGCCCAACAAGATGCTAGAGCATCTCGAGATGCTCTAGCATCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1948s1c1
Sequence:CCGGGCACGAATGGAGCAAACCATACTCGAGTATGGTTTGCTCCATTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1582s1c1
Sequence:CCGGGCGCTGAATTGCATTATGGAACTCGAGTTCCATAATGCAATTCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-872s1c1
Sequence:CCGGGCAAGTTGAAACGCTTTCTTACTCGAGTAAGAAAGCGTTTCAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1476s21c1
Sequence:CCGGGCATCGAGAAGTTCGTGATAGCTCGAGCTATCACGAACTTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005093.3-3451s21c1
Sequence:CCGGCATAGTTACAGGTCATTATATCTCGAGATATAATGACCTGTAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1415s21c1
Sequence:GTACCGGATTACACCTTAGAGGATATTGCTCGAGCAATATCCTCTAAGGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1498s21c1
Sequence:CCGGCACCACAGTCTTGGTCTAAATCTCGAGATTTAGACCAAGACTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1587s21c1
Sequence:CCGGTCTTGACCATGCGCTGAATTGCTCGAGCAATTCAGCGCATGGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005093
CBFA2T2 MISSION shRNA shRNA Plasmid DNA
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005093.2-3657s1c1
Sequence:CCGGCCCACATTCTTCCCTGTCTTTCTCGAGAAAGACAGGGAAGAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1444s1c1
Sequence:CCGGCCCAACAAGATGCTAGAGCATCTCGAGATGCTCTAGCATCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1948s1c1
Sequence:CCGGGCACGAATGGAGCAAACCATACTCGAGTATGGTTTGCTCCATTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1582s1c1
Sequence:CCGGGCGCTGAATTGCATTATGGAACTCGAGTTCCATAATGCAATTCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-872s1c1
Sequence:CCGGGCAAGTTGAAACGCTTTCTTACTCGAGTAAGAAAGCGTTTCAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1476s21c1
Sequence:CCGGGCATCGAGAAGTTCGTGATAGCTCGAGCTATCACGAACTTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005093.3-3451s21c1
Sequence:CCGGCATAGTTACAGGTCATTATATCTCGAGATATAATGACCTGTAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1415s21c1
Sequence:GTACCGGATTACACCTTAGAGGATATTGCTCGAGCAATATCCTCTAAGGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1498s21c1
Sequence:CCGGCACCACAGTCTTGGTCTAAATCTCGAGATTTAGACCAAGACTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1587s21c1
Sequence:CCGGTCTTGACCATGCGCTGAATTGCTCGAGCAATTCAGCGCATGGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005093
CBFA2T2 MISSION shRNA Lentiviral Transduction Particles
core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005093.2-3657s1c1
Sequence:CCGGCCCACATTCTTCCCTGTCTTTCTCGAGAAAGACAGGGAAGAATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1444s1c1
Sequence:CCGGCCCAACAAGATGCTAGAGCATCTCGAGATGCTCTAGCATCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1948s1c1
Sequence:CCGGGCACGAATGGAGCAAACCATACTCGAGTATGGTTTGCTCCATTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-1582s1c1
Sequence:CCGGGCGCTGAATTGCATTATGGAACTCGAGTTCCATAATGCAATTCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005093.2-872s1c1
Sequence:CCGGGCAAGTTGAAACGCTTTCTTACTCGAGTAAGAAAGCGTTTCAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1476s21c1
Sequence:CCGGGCATCGAGAAGTTCGTGATAGCTCGAGCTATCACGAACTTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005093.3-3451s21c1
Sequence:CCGGCATAGTTACAGGTCATTATATCTCGAGATATAATGACCTGTAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1415s21c1
Sequence:GTACCGGATTACACCTTAGAGGATATTGCTCGAGCAATATCCTCTAAGGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1498s21c1
Sequence:CCGGCACCACAGTCTTGGTCTAAATCTCGAGATTTAGACCAAGACTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005093.3-1587s21c1
Sequence:CCGGTCTTGACCATGCGCTGAATTGCTCGAGCAATTCAGCGCATGGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks