EMAIL THIS PAGE TO A FRIEND

CBFA2T3

core-binding factor, runt domain, alpha subunit 2; translocated to, 3

115 Gene Product Result for
Synonyms: ETO2 MTG16 MTGR2 ZMYND4
Gene ID:
Human(863) Summary: This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
Mouse(12398) core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
Rat(361431) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
naked mole-rat(101709583) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
domestic guinea pig(100730951) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
sheep(101109116) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
chicken(415846) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
domestic cat(101099675) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
dog(489660) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
cow(523815) core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077071 MISSION® esiRNA esiRNA human CBFA2T3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005187 Rosetta Predictions human pricing
NM_175931 Rosetta Predictions human pricing
NM_001108453 Rosetta Predictions rat pricing
NM_001109873 Rosetta Predictions mouse pricing
NM_009824 Rosetta Predictions mouse pricing
NM_177289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092277 predicted 794
2 SASI_Hs01_00092278 predicted 962
3 SASI_Hs01_00092279 predicted 814
4 SASI_Hs01_00092280 predicted 1891
5 SASI_Hs01_00092281 predicted 955
6 SASI_Hs01_00092282 predicted 940
7 SASI_Hs01_00092283 predicted 1896
8 SASI_Hs01_00092284 predicted 1025
9 SASI_Hs01_00092285 predicted 1900
10 SASI_Hs01_00092286 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142411 predicted 561
2 SASI_Hs01_00142412 predicted 724
3 SASI_Hs01_00142413 predicted 583
4 SASI_Hs01_00142414 predicted 1659
5 SASI_Hs01_00142415 predicted 727
6 SASI_Hs01_00142416 predicted 708
7 SASI_Hs01_00142417 predicted 1665
8 SASI_Hs01_00142418 predicted 796
9 SASI_Hs01_00142419 predicted 1672
10 SASI_Hs01_00142420 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238789 predicted 2117
2 SASI_Rn02_00238790 predicted 1832
3 SASI_Rn02_00238791 predicted 349
4 SASI_Rn02_00238792 predicted 1541
5 SASI_Rn02_00238793 predicted 942
6 SASI_Rn02_00238794 predicted 708
7 SASI_Rn02_00238795 predicted 1208
8 SASI_Rn02_00238796 predicted 1448
9 SASI_Rn02_00238797 predicted 1721
10 SASI_Rn02_00238798 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304364 predicted 1349
2 SASI_Mm02_00304365 predicted 833
3 SASI_Mm02_00304366 predicted 1929
4 SASI_Mm02_00304367 predicted 1663
5 SASI_Mm02_00304368 predicted 769
6 SASI_Mm02_00304369 predicted 1348
7 SASI_Mm02_00304370 predicted 1973
8 SASI_Mm02_00304371 predicted 1041
9 SASI_Mm02_00304372 predicted 839
10 SASI_Mm02_00304373 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317146 predicted 1328
2 SASI_Mm02_00317147 predicted 817
3 SASI_Mm02_00317148 predicted 1909
4 SASI_Mm02_00317149 predicted 1642
5 SASI_Mm02_00317150 predicted 753
6 SASI_Mm02_00317151 predicted 1334
7 SASI_Mm02_00317152 predicted 1957
8 SASI_Mm02_00317153 predicted 1021
9 SASI_Mm02_00317154 predicted 814
10 SASI_Mm02_00317155 predicted 1641
11 SASI_Mm01_00028870 predicted 365
12 SASI_Mm01_00028871 predicted 452
13 SASI_Mm01_00028872 predicted 962
14 SASI_Mm01_00028873 predicted 1558
15 SASI_Mm01_00028874 predicted 1185
16 SASI_Mm01_00028875 predicted 648
17 SASI_Mm01_00028876 predicted 1731
18 SASI_Mm01_00028877 predicted 1470
19 SASI_Mm01_00028878 predicted 1210
20 SASI_Mm01_00028879 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347348 predicted 1271
2 SASI_Mm02_00347349 predicted 753
3 SASI_Mm02_00347350 predicted 1851
4 SASI_Mm02_00347351 predicted 1580
5 SASI_Mm02_00347352 predicted 694
6 SASI_Mm02_00347353 predicted 1275
7 SASI_Mm02_00347354 predicted 1900
8 SASI_Mm02_00347355 predicted 965
9 SASI_Mm02_00347356 predicted 756
10 SASI_Mm02_00347357 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005187
VALIDATED
CBFA2T3 MISSION shRNA Bacterial Glycerol Stock
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005187.4-1044s21c1
Sequence:CCGGAGTCAACGAGAACGGCAAGAGCTCGAGCTCTTGCCGTTCTCGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005187.4-2417s21c1
Sequence:CCGGAGAAGCCTCGACTGAGCTTTACTCGAGTAAAGCTCAGTCGAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-1392s1c1
Sequence:CCGGCCTGAACTGCATCATGGACATCTCGAGATGTCCATGATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005187.4-582s1c1
Sequence:CCGGCCACTCACCAACAGCCATCAACTCGAGTTGATGGCTGTTGGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-826s1c1
Sequence:CCGGGAGGAGTTTCATTCCAAGCTTCTCGAGAAGCTTGGAATGAAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005187
VALIDATED
CBFA2T3 MISSION shRNA shRNA Plasmid DNA
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005187.4-1044s21c1
Sequence:CCGGAGTCAACGAGAACGGCAAGAGCTCGAGCTCTTGCCGTTCTCGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005187.4-2417s21c1
Sequence:CCGGAGAAGCCTCGACTGAGCTTTACTCGAGTAAAGCTCAGTCGAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-1392s1c1
Sequence:CCGGCCTGAACTGCATCATGGACATCTCGAGATGTCCATGATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005187.4-582s1c1
Sequence:CCGGCCACTCACCAACAGCCATCAACTCGAGTTGATGGCTGTTGGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-826s1c1
Sequence:CCGGGAGGAGTTTCATTCCAAGCTTCTCGAGAAGCTTGGAATGAAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005187
VALIDATED
CBFA2T3 MISSION shRNA Lentiviral Transduction Particles
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005187.4-1044s21c1
Sequence:CCGGAGTCAACGAGAACGGCAAGAGCTCGAGCTCTTGCCGTTCTCGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005187.4-2417s21c1
Sequence:CCGGAGAAGCCTCGACTGAGCTTTACTCGAGTAAAGCTCAGTCGAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-1392s1c1
Sequence:CCGGCCTGAACTGCATCATGGACATCTCGAGATGTCCATGATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005187.4-582s1c1
Sequence:CCGGCCACTCACCAACAGCCATCAACTCGAGTTGATGGCTGTTGGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005187.4-826s1c1
Sequence:CCGGGAGGAGTTTCATTCCAAGCTTCTCGAGAAGCTTGGAATGAAACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009824
CBFA2T3 MISSION shRNA Bacterial Glycerol Stock
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009824.1-2446s1c1
Sequence:CCGGGCAAACAAGCTACTTAGAAATCTCGAGATTTCTAAGTAGCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1161s1c1
Sequence:CCGGCGACAAGAAGAAGTGATTGATCTCGAGATCAATCACTTCTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1656s1c1
Sequence:CCGGCTGACTGTCATCAACCAGCAACTCGAGTTGCTGGTTGATGACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-654s1c1
Sequence:CCGGCTGACGATCGAAGAGTTTCATCTCGAGATGAAACTCTTCGATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-707s1c1
Sequence:CCGGGAGGCCGTTTGTTATCCCTTTCTCGAGAAAGGGATAACAAACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009824
CBFA2T3 MISSION shRNA shRNA Plasmid DNA
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009824.1-2446s1c1
Sequence:CCGGGCAAACAAGCTACTTAGAAATCTCGAGATTTCTAAGTAGCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1161s1c1
Sequence:CCGGCGACAAGAAGAAGTGATTGATCTCGAGATCAATCACTTCTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1656s1c1
Sequence:CCGGCTGACTGTCATCAACCAGCAACTCGAGTTGCTGGTTGATGACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-654s1c1
Sequence:CCGGCTGACGATCGAAGAGTTTCATCTCGAGATGAAACTCTTCGATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-707s1c1
Sequence:CCGGGAGGCCGTTTGTTATCCCTTTCTCGAGAAAGGGATAACAAACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009824
CBFA2T3 MISSION shRNA Lentiviral Transduction Particles
core-binding factor, runt domain, alpha subunit 2; translocated to, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009824.1-2446s1c1
Sequence:CCGGGCAAACAAGCTACTTAGAAATCTCGAGATTTCTAAGTAGCTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1161s1c1
Sequence:CCGGCGACAAGAAGAAGTGATTGATCTCGAGATCAATCACTTCTTCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-1656s1c1
Sequence:CCGGCTGACTGTCATCAACCAGCAACTCGAGTTGCTGGTTGATGACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-654s1c1
Sequence:CCGGCTGACGATCGAAGAGTTTCATCTCGAGATGAAACTCTTCGATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009824.1-707s1c1
Sequence:CCGGGAGGCCGTTTGTTATCCCTTTCTCGAGAAAGGGATAACAAACGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks