EMAIL THIS PAGE TO A FRIEND

CBFB

core-binding factor, beta subunit

209 Gene Product Result for
Synonyms: PEBP2B
UniProtKB ID: Q13951, A8K347, Q13124, Q9HCT2
Gene ID:
Human(865) Summary: The protein encoded by this gene is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family which master-regulates a host of genes specific to hematopoiesis (e.g., RUNX1) and osteogenesis (e.g., RUNX2). The beta subunit is a non-DNA binding regulatory subunit; it allosterically enhances DNA binding by alpha subunit as the complex binds to the core site of various enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers and GM-CSF promoters. Alternative splicing generates two mRNA variants, each encoding a distinct carboxyl terminus. In some cases, a pericentric inversion of chromosome 16 [inv(16)(p13q22)]
Mouse(12400) core binding factor beta
Rat(361391) core-binding factor, beta subunit
Zebrafish(30744) core-binding factor, beta subunit
dog(479690) core-binding factor, beta subunit
cow(614678) core-binding factor, beta subunit
domestic cat(101087541) core-binding factor, beta subunit
chicken(395257) core-binding factor, beta subunit
sheep(101106455) core-binding factor, beta subunit
domestic guinea pig(100733237) core-binding factor, beta subunit
naked mole-rat(101723908) core-binding factor, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001755 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121261 MISSION® esiRNA esiRNA human CBFB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001755 Rosetta Predictions human pricing
NM_022845 Rosetta Predictions human pricing
NM_001013191 Rosetta Predictions rat pricing
NM_022309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110759 predicted 502
2 SASI_Hs01_00110760 predicted 493
3 SASI_Hs01_00110761 predicted 504
4 SASI_Hs01_00110762 predicted 487
5 SASI_Hs01_00110763 predicted 559
6 SASI_Hs01_00110765 predicted 439
7 SASI_Hs01_00110766 predicted 954
8 SASI_Hs01_00110767 predicted 707
9 SASI_Hs01_00110768 predicted 289
10 SASI_Hs02_00332479 predicted 681
11 SASI_Hs01_00110764 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235817 predicted 508
2 SASI_Hs01_00235818 predicted 491
3 SASI_Hs01_00235819 predicted 505
4 SASI_Hs01_00235820 predicted 495
5 SASI_Hs01_00235821 predicted 555
6 SASI_Hs01_00235823 predicted 433
7 SASI_Hs01_00235824 predicted 923
8 SASI_Hs01_00235825 predicted 705
9 SASI_Hs01_00235826 predicted 284
10 SASI_Hs02_00356162 predicted 683
11 SASI_Hs01_00235822 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058700 predicted 625
2 SASI_Rn01_00058701 predicted 759
3 SASI_Rn01_00058702 predicted 454
4 SASI_Rn01_00058703 predicted 616
5 SASI_Rn02_00200952 predicted 583
6 SASI_Rn01_00058706 predicted 456
7 SASI_Rn01_00058707 predicted 896
8 SASI_Rn01_00058708 predicted 583
9 SASI_Rn01_00058709 predicted 726
10 SASI_Rn02_00200953 predicted 698
11 SASI_Rn01_00058704 predicted 525
12 SASI_Rn01_00058705 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169028 predicted 645
2 SASI_Mm01_00169029 predicted 480
3 SASI_Mm01_00169030 predicted 631
4 SASI_Mm02_00326523 predicted 527
5 SASI_Mm01_00169032 predicted 603
6 SASI_Mm01_00169033 predicted 525
7 SASI_Mm01_00169034 predicted 718
8 SASI_Mm01_00169035 predicted 543
9 SASI_Mm01_00169036 predicted 375
10 SASI_Mm01_00169037 predicted 323
11 SASI_Mm01_00169031 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022309
VALIDATED
CBFB MISSION shRNA Bacterial Glycerol Stock
core-binding factor, beta subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022309.2-2589s1c1
Sequence:CCGGCCTCTGTAAATAGCAAATGTTCTCGAGAACATTTGCTATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-638s1c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-538s1c1
Sequence:CCGGCAAACACCTAGCCGGGAATATCTCGAGATATTCCCGGCTAGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022309.2-739s1c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-378s1c1
Sequence:CCGGCGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-547s21c1
Sequence:CCGGGCCGGGAATATGTCGACTTAGCTCGAGCTAAGTCGACATATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-738s21c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022309.4-637s21c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-846s21c1
Sequence:CCGGGATGATCTCAAACTTCGTTAACTCGAGTTAACGAAGTTTGAGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022309
VALIDATED
CBFB MISSION shRNA shRNA Plasmid DNA
core-binding factor, beta subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022309.2-2589s1c1
Sequence:CCGGCCTCTGTAAATAGCAAATGTTCTCGAGAACATTTGCTATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-638s1c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-538s1c1
Sequence:CCGGCAAACACCTAGCCGGGAATATCTCGAGATATTCCCGGCTAGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022309.2-739s1c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-378s1c1
Sequence:CCGGCGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-547s21c1
Sequence:CCGGGCCGGGAATATGTCGACTTAGCTCGAGCTAAGTCGACATATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-738s21c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022309.4-637s21c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-846s21c1
Sequence:CCGGGATGATCTCAAACTTCGTTAACTCGAGTTAACGAAGTTTGAGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022309
VALIDATED
CBFB MISSION shRNA Lentiviral Transduction Particles
core-binding factor, beta subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022309.2-2589s1c1
Sequence:CCGGCCTCTGTAAATAGCAAATGTTCTCGAGAACATTTGCTATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-638s1c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-538s1c1
Sequence:CCGGCAAACACCTAGCCGGGAATATCTCGAGATATTCCCGGCTAGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022309.2-739s1c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022309.2-378s1c1
Sequence:CCGGCGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-547s21c1
Sequence:CCGGGCCGGGAATATGTCGACTTAGCTCGAGCTAAGTCGACATATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-738s21c1
Sequence:CCGGGCTCGAAGAAGAACTCGAGAACTCGAGTTCTCGAGTTCTTCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022309.4-637s21c1
Sequence:CCGGGCTGGATTGATCTCCACAGATCTCGAGATCTGTGGAGATCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022309.4-846s21c1
Sequence:CCGGGATGATCTCAAACTTCGTTAACTCGAGTTAACGAAGTTTGAGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001755
CBFB MISSION shRNA Bacterial Glycerol Stock
core-binding factor, beta subunit
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001755.1-86s1c1
Sequence:CCGGTGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-530s21c1
Sequence:CCGGGAGAAGCAGGCAAGGTATATTCTCGAGAATATACCTTGCCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-774s21c1
Sequence:CCGGGCTGGCAGTAACTGGCAAGAACTCGAGTTCTTGCCAGTTACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001755
CBFB MISSION shRNA shRNA Plasmid DNA
core-binding factor, beta subunit
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000016647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001755.1-86s1c1
Sequence:CCGGTGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-530s21c1
Sequence:CCGGGAGAAGCAGGCAAGGTATATTCTCGAGAATATACCTTGCCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-774s21c1
Sequence:CCGGGCTGGCAGTAACTGGCAAGAACTCGAGTTCTTGCCAGTTACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001755
CBFB MISSION shRNA Lentiviral Transduction Particles
core-binding factor, beta subunit
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000016647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001755.1-86s1c1
Sequence:CCGGTGAGATTAAGTACACGGGCTTCTCGAGAAGCCCGTGTACTTAATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-530s21c1
Sequence:CCGGGAGAAGCAGGCAAGGTATATTCTCGAGAATATACCTTGCCTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001755.2-774s21c1
Sequence:CCGGGCTGGCAGTAACTGGCAAGAACTCGAGTTCTTGCCAGTTACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks