EMAIL THIS PAGE TO A FRIEND

CBL

Cbl proto-oncogene, E3 ubiquitin protein ligase

205 Gene Product Result for
Synonyms: C-CBL CBL2 FRA11B NSLL RNF55
UniProtKB ID: P22681, A3KMP8
Gene ID:
Human(867) Summary: This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Mar 2012]
Mouse(12402) Casitas B-lineage lymphoma
Rat(500985) Cbl proto-oncogene, E3 ubiquitin protein ligase
naked mole-rat(101710004) Cbl proto-oncogene, E3 ubiquitin protein ligase
domestic guinea pig(100725041) Cbl proto-oncogene, E3 ubiquitin protein ligase
sheep(101115401) Cbl proto-oncogene, E3 ubiquitin protein ligase
Domestic Rabbit(100342595) Cbl proto-oncogene, E3 ubiquitin protein ligase
Zebrafish(492364) Cas-Br-M (murine) ecotropic retroviral transforming sequence
Thale Cress(824872) cystathionine beta-lyase
cow(527418) Cbl proto-oncogene, E3 ubiquitin protein ligase
Horse(100071403) Cbl proto-oncogene, E3 ubiquitin protein ligase
domestic cat(101096508) Cbl proto-oncogene, E3 ubiquitin protein ligase
dog(489369) Cbl proto-oncogene, E3 ubiquitin protein ligase
chicken(374038) Cbl proto-oncogene, E3 ubiquitin protein ligase
fruit fly(38961) CG7037 gene product from transcript CG7037-RB
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C9603 Anti-c-Cbl antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation, microarray, western blot pricing
SAB4300600 Anti-CBL (Ab-700) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2500205 Anti-CBL antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
PRS3967 Anti-Cbl antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
HPA027956 Anti-CBL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503446 Anti-CBL antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503444 Anti-CBL, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503445 Anti-CBL, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503905 Anti-phospho-CBL (pTyr674) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301444 Anti-phospho-CBL (pTyr674) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4300283 Anti-phospho-CBL (pTyr700) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503904 Anti-phospho-CBL (pTyr700) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503903 Anti-phospho-CBL (pTyr774) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403641 Monoclonal Anti-CBL antibody produced in mouse clone 6D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing
SAB5300500 Monoclonal Anti-CBL antibody produced in mouse clone 3B12, ascites fluid rat, mouse, human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005188 Rosetta Predictions human pricing
XM_001066453 Rosetta Predictions rat pricing
XM_576396 Rosetta Predictions rat pricing
NM_007619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095408 predicted 2307
2 SASI_Hs01_00095409 predicted 1243
3 SASI_Hs01_00095410 predicted 2318
4 SASI_Hs01_00095411 predicted 739
5 SASI_Hs02_00339135 predicted 2281
6 SASI_Hs01_00095413 predicted 1069
7 SASI_Hs01_00095414 predicted 992
8 SASI_Hs01_00095415 predicted 2064
9 SASI_Hs02_00339136 predicted 1259
10 SASI_Hs01_00095416 predicted 745
11 SASI_Hs01_00095412 predicted 2579
12 SASI_Hs01_00095417 predicted 2842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317494 predicted 2391
2 SASI_Rn02_00317495 predicted 770
3 SASI_Rn02_00317496 predicted 1246
4 SASI_Rn02_00317497 predicted 2521
5 SASI_Rn02_00317498 predicted 2801
6 SASI_Rn02_00317499 predicted 1129
7 SASI_Rn02_00317500 predicted 2241
8 SASI_Rn02_00317501 predicted 1008
9 SASI_Rn02_00317502 predicted 2819
10 SASI_Rn02_00317503 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405231 predicted 770
2 SASI_Rn02_00405232 predicted 657
3 SASI_Rn02_00405233 predicted 1251
4 SASI_Rn02_00405234 predicted 1129
5 SASI_Rn02_00405235 predicted 1179
6 SASI_Rn02_00405236 predicted 1052
7 SASI_Rn02_00405237 predicted 997
8 SASI_Rn02_00405238 predicted 1385
9 SASI_Rn02_00405239 predicted 810
10 SASI_Rn02_00405240 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136203 predicted 1510
2 SASI_Mm01_00136204 predicted 1932
3 SASI_Mm01_00136205 predicted 531
4 SASI_Mm01_00136206 predicted 2643
5 SASI_Mm02_00312072 predicted 2430
6 SASI_Mm01_00136207 predicted 1091
7 SASI_Mm01_00136208 predicted 600
8 SASI_Mm01_00136209 predicted 1295
9 SASI_Mm01_00136210 predicted 2656
10 SASI_Mm01_00136211 predicted 1007
11 SASI_Mm01_00136212 predicted 1752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005188
VALIDATED
CBL MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-412s21c1
Sequence:GTACCGGTACCAGCATCTCCGTACTATCCTCGAGGATAGTACGGAGATGCTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-667s21c1
Sequence:GTACCGGGACACATTTCGGATTACTAAACTCGAGTTTAGTAATCCGAAATGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2324s21c1
Sequence:GTACCGGGTACGTATGAAGCAATGTATACTCGAGTATACATTGCTTCATACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-1092s21c1
Sequence:CCGGCCCTCACAATAAACCTCTCTTCTCGAGAAGAGAGGTTTATTGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2891s21c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-1394s21c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-822s21c1
Sequence:CCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2982s21c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGTGGAACCACTGATGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2301s21c1
Sequence:GTACCGGTTGCGACCAGCAGATTGATAGCTCGAGCTATCAATCTGCTGGTCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005188.x-302s1c1
Sequence:CCGGACAAGAAGATGGTGGAGAAGCTCGAGCTTCTCCACCATCTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.x-2991s1c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGGGAACCACTGATGTGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-433s1c1
Sequence:CCGGCCGTACTATCTTGTCAAGATACTCGAGTATCTTGACAAGATAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-1404s1c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-2901s1c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005188
VALIDATED
CBL MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-412s21c1
Sequence:GTACCGGTACCAGCATCTCCGTACTATCCTCGAGGATAGTACGGAGATGCTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-667s21c1
Sequence:GTACCGGGACACATTTCGGATTACTAAACTCGAGTTTAGTAATCCGAAATGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2324s21c1
Sequence:GTACCGGGTACGTATGAAGCAATGTATACTCGAGTATACATTGCTTCATACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-1092s21c1
Sequence:CCGGCCCTCACAATAAACCTCTCTTCTCGAGAAGAGAGGTTTATTGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2891s21c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-1394s21c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-822s21c1
Sequence:CCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2982s21c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGTGGAACCACTGATGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2301s21c1
Sequence:GTACCGGTTGCGACCAGCAGATTGATAGCTCGAGCTATCAATCTGCTGGTCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005188.x-302s1c1
Sequence:CCGGACAAGAAGATGGTGGAGAAGCTCGAGCTTCTCCACCATCTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.x-2991s1c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGGGAACCACTGATGTGATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-433s1c1
Sequence:CCGGCCGTACTATCTTGTCAAGATACTCGAGTATCTTGACAAGATAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-1404s1c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-2901s1c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005188
VALIDATED
CBL MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene, E3 ubiquitin protein ligase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-412s21c1
Sequence:GTACCGGTACCAGCATCTCCGTACTATCCTCGAGGATAGTACGGAGATGCTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-667s21c1
Sequence:GTACCGGGACACATTTCGGATTACTAAACTCGAGTTTAGTAATCCGAAATGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2324s21c1
Sequence:GTACCGGGTACGTATGAAGCAATGTATACTCGAGTATACATTGCTTCATACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-1092s21c1
Sequence:CCGGCCCTCACAATAAACCTCTCTTCTCGAGAAGAGAGGTTTATTGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2891s21c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-1394s21c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-822s21c1
Sequence:CCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005188.2-2982s21c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGTGGAACCACTGATGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005188.2-2301s21c1
Sequence:GTACCGGTTGCGACCAGCAGATTGATAGCTCGAGCTATCAATCTGCTGGTCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005188.x-302s1c1
Sequence:CCGGACAAGAAGATGGTGGAGAAGCTCGAGCTTCTCCACCATCTTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.x-2991s1c1
Sequence:CCGGATATCACATCAGTGGTTCCACTCGAGGGAACCACTGATGTGATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-433s1c1
Sequence:CCGGCCGTACTATCTTGTCAAGATACTCGAGTATCTTGACAAGATAGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-1404s1c1
Sequence:CCGGGCCGATGTGAAATTAAAGGTACTCGAGTACCTTTAATTTCACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005188.1-2901s1c1
Sequence:CCGGCCAGTGAGTTGGGAGTTATTACTCGAGTAATAACTCCCAACTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007619
VALIDATED
CBL MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-681s21c1
Sequence:GTACCGGGACACTTTCCGGATTACTAAACTCGAGTTTAGTAATCCGGAAAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-1214s21c1
Sequence:GTACCGGACCAACTCCTCAAGATCATATCTCGAGATATGATCTTGAGGAGTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-836s21c1
Sequence:GTACCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007619.2-3199s21c1
Sequence:GTACCGGGCTGTGCTGTGGCCCTAATTACTCGAGTAATTAGGGCCACAGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-594s21c1
Sequence:GTACCGGAGGCGAAACCTGACCAAATTACTCGAGTAATTTGGTCAGGTTTCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-540s1c1
Sequence:CCGGCCTGACCAAATTATCCCTGATCTCGAGATCAGGGATAATTTGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-471s1c1
Sequence:CCGGGCAGACTATCAGCCTCTTCAACTCGAGTTGAAGAGGCTGATAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-1044s1c1
Sequence:CCGGCCCACACAATAAACCGCTCTTCTCGAGAAGAGCGGTTTATTGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-376s1c1
Sequence:CCGGCGCACTGTCTTGTCAAGATATCTCGAGATATCTTGACAAGACAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-2542s1c1
Sequence:CCGGCCTCGGAGAATCAACTCAGAACTCGAGTTCTGAGTTGATTCTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007619
VALIDATED
CBL MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-681s21c1
Sequence:GTACCGGGACACTTTCCGGATTACTAAACTCGAGTTTAGTAATCCGGAAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-1214s21c1
Sequence:GTACCGGACCAACTCCTCAAGATCATATCTCGAGATATGATCTTGAGGAGTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-836s21c1
Sequence:GTACCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007619.2-3199s21c1
Sequence:GTACCGGGCTGTGCTGTGGCCCTAATTACTCGAGTAATTAGGGCCACAGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-594s21c1
Sequence:GTACCGGAGGCGAAACCTGACCAAATTACTCGAGTAATTTGGTCAGGTTTCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-540s1c1
Sequence:CCGGCCTGACCAAATTATCCCTGATCTCGAGATCAGGGATAATTTGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-471s1c1
Sequence:CCGGGCAGACTATCAGCCTCTTCAACTCGAGTTGAAGAGGCTGATAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-1044s1c1
Sequence:CCGGCCCACACAATAAACCGCTCTTCTCGAGAAGAGCGGTTTATTGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-376s1c1
Sequence:CCGGCGCACTGTCTTGTCAAGATATCTCGAGATATCTTGACAAGACAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-2542s1c1
Sequence:CCGGCCTCGGAGAATCAACTCAGAACTCGAGTTCTGAGTTGATTCTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007619
VALIDATED
CBL MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-681s21c1
Sequence:GTACCGGGACACTTTCCGGATTACTAAACTCGAGTTTAGTAATCCGGAAAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-1214s21c1
Sequence:GTACCGGACCAACTCCTCAAGATCATATCTCGAGATATGATCTTGAGGAGTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-836s21c1
Sequence:GTACCGGTGATCTGACCTGCAATGATTACTCGAGTAATCATTGCAGGTCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007619.2-3199s21c1
Sequence:GTACCGGGCTGTGCTGTGGCCCTAATTACTCGAGTAATTAGGGCCACAGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007619.2-594s21c1
Sequence:GTACCGGAGGCGAAACCTGACCAAATTACTCGAGTAATTTGGTCAGGTTTCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-540s1c1
Sequence:CCGGCCTGACCAAATTATCCCTGATCTCGAGATCAGGGATAATTTGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-471s1c1
Sequence:CCGGGCAGACTATCAGCCTCTTCAACTCGAGTTGAAGAGGCTGATAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-1044s1c1
Sequence:CCGGCCCACACAATAAACCGCTCTTCTCGAGAAGAGCGGTTTATTGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-376s1c1
Sequence:CCGGCGCACTGTCTTGTCAAGATATCTCGAGATATCTTGACAAGACAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007619.1-2542s1c1
Sequence:CCGGCCTCGGAGAATCAACTCAGAACTCGAGTTCTGAGTTGATTCTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)