EMAIL THIS PAGE TO A FRIEND

CBLB

Cbl proto-oncogene B, E3 ubiquitin protein ligase

Synonyms: Cbl-b RNF56
Gene ID:
Mouse(208650) Casitas B-lineage lymphoma b
Rat(171136) Cbl proto-oncogene B, E3 ubiquitin protein ligase
Zebrafish(556277) Cas-Br-M (murine) ecotropic retroviral transforming sequence b
Horse(100061819) Cbl proto-oncogene, E3 ubiquitin protein ligase B
cow(525906) Cas-Br-M (murine) ecotropic retroviral transforming sequence b
domestic cat(101101498) Cbl proto-oncogene, E3 ubiquitin protein ligase B
chicken(418406) Cbl proto-oncogene, E3 ubiquitin protein ligase B
dog(487965) Cbl proto-oncogene, E3 ubiquitin protein ligase B
naked mole-rat(101719173) Cbl proto-oncogene, E3 ubiquitin protein ligase B
domestic guinea pig(100718857) Cbl proto-oncogene, E3 ubiquitin protein ligase B
sheep(101114404) Cbl proto-oncogene, E3 ubiquitin protein ligase B
Domestic Rabbit(100355469) Cbl proto-oncogene, E3 ubiquitin protein ligase B
Gene Class: Calcium_Binding
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170662 Rosetta Predictions human pricing
NM_133601 Rosetta Predictions rat pricing
NM_001033238 Rosetta Predictions mouse pricing
XM_001003639 Rosetta Predictions mouse pricing
XM_001003649 Rosetta Predictions mouse pricing
XM_156257 Rosetta Predictions mouse pricing
XM_902056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367566 predicted 390
2 SASI_Hs01_00112584 predicted 1105
3 SASI_Hs01_00112586 predicted 336
4 SASI_Hs01_00112588 predicted 2964
5 SASI_Hs01_00112589 predicted 560
6 SASI_Hs01_00112590 predicted 819
7 SASI_Hs02_00367567 predicted 2636
8 SASI_Hs01_00112593 predicted 2679
9 SASI_Hs02_00367568 predicted 547
10 SASI_Hs02_00367569 predicted 2039
11 SASI_Hs01_00112585 predicted 568
12 SASI_Hs01_00112587 predicted 764
13 SASI_Hs01_00112591 predicted 1471
14 SASI_Hs01_00112592 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043097 predicted 1302
2 SASI_Rn01_00043098 predicted 2080
3 SASI_Rn01_00043099 predicted 699
4 SASI_Rn01_00043100 predicted 835
5 SASI_Rn01_00043101 predicted 1114
6 SASI_Rn01_00043103 predicted 919
7 SASI_Rn01_00043104 predicted 688
8 SASI_Rn01_00043105 predicted 1045
9 SASI_Rn01_00043106 predicted 1758
10 SASI_Rn02_00267820 predicted 277
11 SASI_Rn01_00043102 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288374 predicted 621
2 SASI_Mm02_00288375 predicted 391
3 SASI_Mm02_00288376 predicted 2051
4 SASI_Mm02_00288377 predicted 800
5 SASI_Mm02_00288378 predicted 2194
6 SASI_Mm02_00288379 predicted 1021
7 SASI_Mm02_00288380 predicted 942
8 SASI_Mm02_00288381 predicted 955
9 SASI_Mm02_00288382 predicted 534
10 SASI_Mm02_00288383 predicted 2990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273416 predicted 2760
2 SASI_Mm01_00273417 predicted 1067
3 SASI_Mm01_00273418 predicted 621
4 SASI_Mm01_00273419 predicted 843
5 SASI_Mm01_00273420 predicted 2499
6 SASI_Mm01_00273421 predicted 1248
7 SASI_Mm01_00273422 predicted 2637
8 SASI_Mm01_00273423 predicted 1479
9 SASI_Mm01_00273424 predicted 1390
10 SASI_Mm01_00273425 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247076 predicted 948
2 SASI_Mm01_00247077 predicted 499
3 SASI_Mm01_00247078 predicted 721
4 SASI_Mm01_00247079 predicted 2386
5 SASI_Mm01_00247080 predicted 1127
6 SASI_Mm01_00247081 predicted 2518
7 SASI_Mm01_00247082 predicted 1601
8 SASI_Mm01_00247083 predicted 1355
9 SASI_Mm01_00247084 predicted 1270
10 SASI_Mm01_00247085 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_156257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212246 predicted 694
2 SASI_Mm01_00212247 predicted 241
3 SASI_Mm01_00212248 predicted 464
4 SASI_Mm01_00212249 predicted 2124
5 SASI_Mm01_00212250 predicted 876
6 SASI_Mm01_00212251 predicted 2262
7 SASI_Mm01_00212252 predicted 1345
8 SASI_Mm01_00212253 predicted 1102
9 SASI_Mm01_00212254 predicted 1014
10 SASI_Mm01_00212255 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275832 predicted 1902
2 SASI_Mm01_00275833 predicted 208
3 SASI_Mm01_00275834 predicted 1640
4 SASI_Mm01_00275835 predicted 391
5 SASI_Mm01_00275836 predicted 1778
6 SASI_Mm01_00275837 predicted 870
7 SASI_Mm01_00275838 predicted 619
8 SASI_Mm01_00275839 predicted 530
9 SASI_Mm01_00275840 predicted 2707
10 SASI_Mm01_00275841 predicted 2631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170662
VALIDATED
CBLB MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-343s1c1
Sequence:CCGGATGCTATTCAGGATGCAGTTCTCGAGAACTGCATCCTGAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2650s1c1
Sequence:CCGGTACATCTTAATGGTCAGAATTCTCGAGAATTCTGACCATTAAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-3648s1c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-3129s1c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2049s1c1
Sequence:CCGGCGGGATGTGTTTGGGACTAATCTCGAGATTAGTCCCAAACACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-1206s1c1
Sequence:CCGGCCCTTATTTCAAGCCCTGATTCTCGAGAATCAGGGCTTGAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1154s21c1
Sequence:GTACCGGACCAAACCCGGAAGCTATATTCTCGAGAATATAGCTTCCGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1177s21c1
Sequence:CCGGCCGGTTAAGTTGCACTCGATTCTCGAGAATCGAGTGCAACTTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-565s21c1
Sequence:CCGGATATCAGCATTTACGACTTATCTCGAGATAAGTCGTAAATGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1362s21c1
Sequence:CCGGCTACACCTCATGACCATATAACTCGAGTTATATGGTCATGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170662.3-3707s21c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-3188s21c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-2356s21c1
Sequence:GTACCGGCACCCTCCTCCCTAGCATAAACTCGAGTTTATGCTAGGGAGGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170662
VALIDATED
CBLB MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-343s1c1
Sequence:CCGGATGCTATTCAGGATGCAGTTCTCGAGAACTGCATCCTGAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2650s1c1
Sequence:CCGGTACATCTTAATGGTCAGAATTCTCGAGAATTCTGACCATTAAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-3648s1c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-3129s1c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2049s1c1
Sequence:CCGGCGGGATGTGTTTGGGACTAATCTCGAGATTAGTCCCAAACACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-1206s1c1
Sequence:CCGGCCCTTATTTCAAGCCCTGATTCTCGAGAATCAGGGCTTGAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1154s21c1
Sequence:GTACCGGACCAAACCCGGAAGCTATATTCTCGAGAATATAGCTTCCGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1177s21c1
Sequence:CCGGCCGGTTAAGTTGCACTCGATTCTCGAGAATCGAGTGCAACTTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-565s21c1
Sequence:CCGGATATCAGCATTTACGACTTATCTCGAGATAAGTCGTAAATGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1362s21c1
Sequence:CCGGCTACACCTCATGACCATATAACTCGAGTTATATGGTCATGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170662.3-3707s21c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-3188s21c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-2356s21c1
Sequence:GTACCGGCACCCTCCTCCCTAGCATAAACTCGAGTTTATGCTAGGGAGGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170662
VALIDATED
CBLB MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-343s1c1
Sequence:CCGGATGCTATTCAGGATGCAGTTCTCGAGAACTGCATCCTGAATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2650s1c1
Sequence:CCGGTACATCTTAATGGTCAGAATTCTCGAGAATTCTGACCATTAAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170662.2-3648s1c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-3129s1c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-2049s1c1
Sequence:CCGGCGGGATGTGTTTGGGACTAATCTCGAGATTAGTCCCAAACACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170662.2-1206s1c1
Sequence:CCGGCCCTTATTTCAAGCCCTGATTCTCGAGAATCAGGGCTTGAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1154s21c1
Sequence:GTACCGGACCAAACCCGGAAGCTATATTCTCGAGAATATAGCTTCCGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1177s21c1
Sequence:CCGGCCGGTTAAGTTGCACTCGATTCTCGAGAATCGAGTGCAACTTAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-565s21c1
Sequence:CCGGATATCAGCATTTACGACTTATCTCGAGATAAGTCGTAAATGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-1362s21c1
Sequence:CCGGCTACACCTCATGACCATATAACTCGAGTTATATGGTCATGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170662.3-3707s21c1
Sequence:CCGGCCACATCAACAGCTAAATCATCTCGAGATGATTTAGCTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-3188s21c1
Sequence:CCGGGCCCAGAATAATGTCGAAGTTCTCGAGAACTTCGACATTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170662.3-2356s21c1
Sequence:GTACCGGCACCCTCCTCCCTAGCATAAACTCGAGTTTATGCTAGGGAGGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033238
CBLB MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033238.1-3799s21c1
Sequence:CCGGCTTGTACTCCAGTACCATAATCTCGAGATTATGGTACTGGAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1165s21c1
Sequence:CCGGCCCTGATTTAACCGGATTATGCTCGAGCATAATCCGGTTAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-453s21c1
Sequence:CCGGTGAGCGAGAATGAGTACTTTACTCGAGTAAAGTACTCATTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-2423s21c1
Sequence:CCGGCCAGATTTAGGCATCTATTTGCTCGAGCAAATAGATGCCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1191s21c1
Sequence:CCGGCTACACCTCACGATCATATAACTCGAGTTATATGATCGTGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033238
CBLB MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033238.1-3799s21c1
Sequence:CCGGCTTGTACTCCAGTACCATAATCTCGAGATTATGGTACTGGAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1165s21c1
Sequence:CCGGCCCTGATTTAACCGGATTATGCTCGAGCATAATCCGGTTAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-453s21c1
Sequence:CCGGTGAGCGAGAATGAGTACTTTACTCGAGTAAAGTACTCATTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-2423s21c1
Sequence:CCGGCCAGATTTAGGCATCTATTTGCTCGAGCAAATAGATGCCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1191s21c1
Sequence:CCGGCTACACCTCACGATCATATAACTCGAGTTATATGATCGTGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033238
CBLB MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene B, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033238.1-3799s21c1
Sequence:CCGGCTTGTACTCCAGTACCATAATCTCGAGATTATGGTACTGGAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1165s21c1
Sequence:CCGGCCCTGATTTAACCGGATTATGCTCGAGCATAATCCGGTTAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-453s21c1
Sequence:CCGGTGAGCGAGAATGAGTACTTTACTCGAGTAAAGTACTCATTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-2423s21c1
Sequence:CCGGCCAGATTTAGGCATCTATTTGCTCGAGCAAATAGATGCCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033238.1-1191s21c1
Sequence:CCGGCTACACCTCACGATCATATAACTCGAGTTATATGATCGTGAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks