EMAIL THIS PAGE TO A FRIEND

CBLC

Cbl proto-oncogene C, E3 ubiquitin protein ligase

68 Gene Product Result for
Synonyms: CBL-3 CBL-SL RNF57
UniProtKB ID: Q9ULV8, Q8N1E5, Q9Y5Z2, Q9Y5Z3
Gene ID:
Human(23624) Summary: This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(80794) Casitas B-lineage lymphoma c
Rat(292699) Cbl proto-oncogene C, E3 ubiquitin protein ligase
sheep(101111043) Cbl proto-oncogene, E3 ubiquitin protein ligase C
domestic guinea pig(100718565) Cbl proto-oncogene, E3 ubiquitin protein ligase C
naked mole-rat(101713714) Cbl proto-oncogene, E3 ubiquitin protein ligase C
cow(615866) Cas-Br-M (murine) ecotropic retroviral transforming sequence c
domestic cat(101095782) Cbl proto-oncogene, E3 ubiquitin protein ligase C
dog(612343) Cbl proto-oncogene, E3 ubiquitin protein ligase C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012116 Rosetta Predictions human pricing
NM_001034920 Rosetta Predictions rat pricing
NM_023224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210269 predicted 1227
2 SASI_Hs01_00210270 predicted 1077
3 SASI_Hs01_00210271 predicted 1245
4 SASI_Hs01_00210272 predicted 763
5 SASI_Hs01_00210273 predicted 1077
6 SASI_Hs01_00210274 predicted 1246
7 SASI_Hs01_00210275 predicted 701
8 SASI_Hs01_00210276 predicted 740
9 SASI_Hs02_00343651 predicted 1028
10 SASI_Hs01_00210277 predicted 505
11 SASI_Hs01_00210278 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112313 predicted 764
2 SASI_Rn01_00112314 predicted 369
3 SASI_Rn01_00112315 predicted 794
4 SASI_Rn01_00112316 predicted 727
5 SASI_Rn01_00112318 predicted 993
6 SASI_Rn01_00112320 predicted 700
7 SASI_Rn01_00112321 predicted 1369
8 SASI_Rn02_00204060 predicted 1395
9 SASI_Rn01_00112322 predicted 844
10 SASI_Rn02_00204061 predicted 862
11 SASI_Rn01_00112317 predicted 711
12 SASI_Rn01_00112319 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100678 predicted 1089
2 SASI_Mm01_00100679 predicted 644
3 SASI_Mm01_00100680 predicted 785
4 SASI_Mm01_00100681 predicted 608
5 SASI_Mm01_00100682 predicted 875
6 SASI_Mm02_00326979 predicted 1012
7 SASI_Mm01_00100683 predicted 1344
8 SASI_Mm01_00100684 predicted 709
9 SASI_Mm01_00100685 predicted 632
10 SASI_Mm01_00100686 predicted 622
11 SASI_Mm01_00100687 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012116
CBLC MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-759s21c1
Sequence:GTACCGGAGTCAACCACCCAGGCTACATCTCGAGATGTAGCCTGGGTGGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-428s21c1
Sequence:GTACCGGCCAAGCTGGCCATCATCTTCACTCGAGTGAAGATGATGGCCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-828s21c1
Sequence:GTACCGGGGACAAGCCAGGCAGTTACATCTCGAGATGTAACTGCCTGGCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-303s21c1
Sequence:GTACCGGACTCATCTACCTGGCCAATCTCTCGAGAGATTGGCCAGGTAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1133s21c1
Sequence:GTACCGGGCAACAAGGATGTGAAGATTGCTCGAGCAATCTTCACATCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-790s21c1
Sequence:GTACCGGACCTATGATGAGGTCCAAGAGCTCGAGCTCTTGGACCTCATCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1416s21c1
Sequence:GTACCGGGCCGAAAGTGAGACTCCTAAACTCGAGTTTAGGAGTCTCACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-488s21c1
Sequence:GTACCGGGAAAGTACTGTGGACACATGTCTCGAGACATGTGTCCACAGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-202s1c1
Sequence:CCGGTGCTTCGAGAGGTGGCCCATTCTCGAGAATGGGCCACCTCTCGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-279s1c1
Sequence:CCGGCTACTCATCTACCTGGCCAATCTCGAGATTGGCCAGGTAGATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-1380s1c1
Sequence:CCGGCCCAGAAATGCCCAGCCGAAACTCGAGTTTCGGCTGGGCATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-656s1c1
Sequence:CCGGCGTGTCCATCTTCGAGTTCGACTCGAGTCGAACTCGAAGATGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012116.x-1525s1c1
Sequence:CCGGGAAACCGAAATAAACTGCCAACTCGAGTTGGCAGTTTATTTCGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012116
CBLC MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-759s21c1
Sequence:GTACCGGAGTCAACCACCCAGGCTACATCTCGAGATGTAGCCTGGGTGGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-428s21c1
Sequence:GTACCGGCCAAGCTGGCCATCATCTTCACTCGAGTGAAGATGATGGCCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-828s21c1
Sequence:GTACCGGGGACAAGCCAGGCAGTTACATCTCGAGATGTAACTGCCTGGCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-303s21c1
Sequence:GTACCGGACTCATCTACCTGGCCAATCTCTCGAGAGATTGGCCAGGTAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1133s21c1
Sequence:GTACCGGGCAACAAGGATGTGAAGATTGCTCGAGCAATCTTCACATCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-790s21c1
Sequence:GTACCGGACCTATGATGAGGTCCAAGAGCTCGAGCTCTTGGACCTCATCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1416s21c1
Sequence:GTACCGGGCCGAAAGTGAGACTCCTAAACTCGAGTTTAGGAGTCTCACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-488s21c1
Sequence:GTACCGGGAAAGTACTGTGGACACATGTCTCGAGACATGTGTCCACAGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-202s1c1
Sequence:CCGGTGCTTCGAGAGGTGGCCCATTCTCGAGAATGGGCCACCTCTCGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-279s1c1
Sequence:CCGGCTACTCATCTACCTGGCCAATCTCGAGATTGGCCAGGTAGATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-1380s1c1
Sequence:CCGGCCCAGAAATGCCCAGCCGAAACTCGAGTTTCGGCTGGGCATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-656s1c1
Sequence:CCGGCGTGTCCATCTTCGAGTTCGACTCGAGTCGAACTCGAAGATGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012116.x-1525s1c1
Sequence:CCGGGAAACCGAAATAAACTGCCAACTCGAGTTGGCAGTTTATTTCGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012116
CBLC MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-759s21c1
Sequence:GTACCGGAGTCAACCACCCAGGCTACATCTCGAGATGTAGCCTGGGTGGTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-428s21c1
Sequence:GTACCGGCCAAGCTGGCCATCATCTTCACTCGAGTGAAGATGATGGCCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-828s21c1
Sequence:GTACCGGGGACAAGCCAGGCAGTTACATCTCGAGATGTAACTGCCTGGCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-303s21c1
Sequence:GTACCGGACTCATCTACCTGGCCAATCTCTCGAGAGATTGGCCAGGTAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1133s21c1
Sequence:GTACCGGGCAACAAGGATGTGAAGATTGCTCGAGCAATCTTCACATCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-790s21c1
Sequence:GTACCGGACCTATGATGAGGTCCAAGAGCTCGAGCTCTTGGACCTCATCATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-1416s21c1
Sequence:GTACCGGGCCGAAAGTGAGACTCCTAAACTCGAGTTTAGGAGTCTCACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012116.3-488s21c1
Sequence:GTACCGGGAAAGTACTGTGGACACATGTCTCGAGACATGTGTCCACAGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-202s1c1
Sequence:CCGGTGCTTCGAGAGGTGGCCCATTCTCGAGAATGGGCCACCTCTCGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-279s1c1
Sequence:CCGGCTACTCATCTACCTGGCCAATCTCGAGATTGGCCAGGTAGATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-1380s1c1
Sequence:CCGGCCCAGAAATGCCCAGCCGAAACTCGAGTTTCGGCTGGGCATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012116.x-656s1c1
Sequence:CCGGCGTGTCCATCTTCGAGTTCGACTCGAGTCGAACTCGAAGATGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012116.x-1525s1c1
Sequence:CCGGGAAACCGAAATAAACTGCCAACTCGAGTTGGCAGTTTATTTCGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023224
VALIDATED
CBLC MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-750s21c1
Sequence:GTACCGGCACCTACGATGAGGTCCAAACCTCGAGGTTTGGACCTCATCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-1187s21c1
Sequence:CCGGTCTGCCGTTGTGAGATCAAAGCTCGAGCTTTGATCTCACAACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-659s21c1
Sequence:CCGGACGTCTTCACCAGGCTCTTTCCTCGAGGAAAGAGCCTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-275s21c1
Sequence:CCGGTGGCCAATCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-335s21c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-879s21c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-791s21c1
Sequence:GTACCGGACAAACCAGGCAGCTATATCTCTCGAGAGATATAGCTGCCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-877s1c1
Sequence:CCGGCCTGCAAACCATTCCTCTCAACTCGAGTTGAGAGGAATGGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023224.3-750s1c1
Sequence:CCGGTCACCTACGATGAGGTCCAAACTCGAGTTTGGACCTCATCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-336s1c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-1340s1c1
Sequence:CCGGCCCTCACTACTCCCTGAAGATCTCGAGATCTTCAGGGAGTAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-880s1c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023224
VALIDATED
CBLC MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-750s21c1
Sequence:GTACCGGCACCTACGATGAGGTCCAAACCTCGAGGTTTGGACCTCATCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-1187s21c1
Sequence:CCGGTCTGCCGTTGTGAGATCAAAGCTCGAGCTTTGATCTCACAACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-659s21c1
Sequence:CCGGACGTCTTCACCAGGCTCTTTCCTCGAGGAAAGAGCCTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-275s21c1
Sequence:CCGGTGGCCAATCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-335s21c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-879s21c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-791s21c1
Sequence:GTACCGGACAAACCAGGCAGCTATATCTCTCGAGAGATATAGCTGCCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-877s1c1
Sequence:CCGGCCTGCAAACCATTCCTCTCAACTCGAGTTGAGAGGAATGGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023224.3-750s1c1
Sequence:CCGGTCACCTACGATGAGGTCCAAACTCGAGTTTGGACCTCATCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-336s1c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-1340s1c1
Sequence:CCGGCCCTCACTACTCCCTGAAGATCTCGAGATCTTCAGGGAGTAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-880s1c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023224
VALIDATED
CBLC MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene C, E3 ubiquitin protein ligase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-750s21c1
Sequence:GTACCGGCACCTACGATGAGGTCCAAACCTCGAGGTTTGGACCTCATCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-1187s21c1
Sequence:CCGGTCTGCCGTTGTGAGATCAAAGCTCGAGCTTTGATCTCACAACGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-659s21c1
Sequence:CCGGACGTCTTCACCAGGCTCTTTCCTCGAGGAAAGAGCCTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-275s21c1
Sequence:CCGGTGGCCAATCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-335s21c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-879s21c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023224.5-791s21c1
Sequence:GTACCGGACAAACCAGGCAGCTATATCTCTCGAGAGATATAGCTGCCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-877s1c1
Sequence:CCGGCCTGCAAACCATTCCTCTCAACTCGAGTTGAGAGGAATGGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023224.3-750s1c1
Sequence:CCGGTCACCTACGATGAGGTCCAAACTCGAGTTTGGACCTCATCGTAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-336s1c1
Sequence:CCGGAGGACGTGAACCAGGATGTTTCTCGAGAAACATCCTGGTTCACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-1340s1c1
Sequence:CCGGCCCTCACTACTCCCTGAAGATCTCGAGATCTTCAGGGAGTAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023224.3-880s1c1
Sequence:CCGGGCAAACCATTCCTCTCAACAACTCGAGTTGTTGAGAGGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks