EMAIL THIS PAGE TO A FRIEND

CBLL1

Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase

71 Gene Product Result for
Synonyms: HAKAI RNF188
UniProtKB ID: Q75N03, Q8TAJ4, Q9H5S6
Gene ID:
Human(79872) Summary: This gene encodes an E3 ubiquitin-ligase for the E-cadherin complex and mediates its ubiquitination, endocytosis, and degradation in the lysosomes. The encoded protein contains a RING-finger domain and is also thought to have a role in control of cell proliferation. A related pseudogene has been identified on chromosome X. Alternative splicing results in a non-coding transcript variant. [provided by RefSeq, Aug 2011]
Mouse(104836) Casitas B-lineage lymphoma-like 1
Rat(314028) Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Zebrafish(394041) Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1
chicken(417701) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
dog(483262) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
domestic cat(101094835) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
cow(524139) Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1
Horse(100050845) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
naked mole-rat(101701435) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
domestic guinea pig(100718115) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
sheep(101104902) Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024814 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024814 Rosetta Predictions human pricing
NM_001108018 Rosetta Predictions rat pricing
NM_134048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020900 predicted 920
2 SASI_Hs01_00020901 predicted 571
3 SASI_Hs01_00020902 predicted 1590
4 SASI_Hs01_00020904 predicted 662
5 SASI_Hs01_00020905 predicted 560
6 SASI_Hs02_00357366 predicted 1283
7 SASI_Hs01_00020908 predicted 1375
8 SASI_Hs02_00357367 predicted 1460
9 SASI_Hs02_00357368 predicted 919
10 SASI_Hs02_00357369 predicted 1478
11 SASI_Hs01_00020903 predicted 1119
12 SASI_Hs01_00020906 predicted 766
13 SASI_Hs01_00020907 predicted 913
14 SASI_Hs01_00020909 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234555 predicted 1251
2 SASI_Rn02_00234556 predicted 242
3 SASI_Rn02_00234557 predicted 1159
4 SASI_Rn02_00234558 predicted 2044
5 SASI_Rn02_00234559 predicted 245
6 SASI_Rn02_00234560 predicted 1839
7 SASI_Rn02_00234561 predicted 1333
8 SASI_Rn02_00234562 predicted 1859
9 SASI_Rn02_00234563 predicted 1830
10 SASI_Rn02_00234564 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339213 predicted 829
2 SASI_Mm01_00048543 predicted 1158
3 SASI_Mm01_00048544 predicted 1172
4 SASI_Mm01_00048545 predicted 828
5 SASI_Mm01_00048546 predicted 1086
6 SASI_Mm01_00048547 predicted 976
7 SASI_Mm01_00048548 predicted 737
8 SASI_Mm02_00339214 predicted 1044
9 SASI_Mm01_00048549 predicted 1265
10 SASI_Mm01_00048550 predicted 1086
11 SASI_Mm01_00048551 predicted 1267
12 SASI_Mm01_00048552 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134048
VALIDATED
CBLL1 MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1628s1c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134048.1-83s1c1
Sequence:CCGGCCCTATAAAGCTCATCTCCAACTCGAGTTGGAGATGAGCTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-871s1c1
Sequence:CCGGGCAATTTAATAACGGTCCCTACTCGAGTAGGGACCGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1268s1c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-872s1c1
Sequence:CCGGCAATTTAATAACGGTCCCTATCTCGAGATAGGGACCGTTATTAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134048.1-1268s21c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134048.1-1628s21c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-985s21c1
Sequence:CCGGTATCTCACCCTCATCATATTACTCGAGTAATATGATGAGGGTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-196s21c1
Sequence:CCGGATAACGAAGAACAGCGATATGCTCGAGCATATCGCTGTTCTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-744s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134048
VALIDATED
CBLL1 MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1628s1c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134048.1-83s1c1
Sequence:CCGGCCCTATAAAGCTCATCTCCAACTCGAGTTGGAGATGAGCTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-871s1c1
Sequence:CCGGGCAATTTAATAACGGTCCCTACTCGAGTAGGGACCGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1268s1c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-872s1c1
Sequence:CCGGCAATTTAATAACGGTCCCTATCTCGAGATAGGGACCGTTATTAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134048.1-1268s21c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134048.1-1628s21c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-985s21c1
Sequence:CCGGTATCTCACCCTCATCATATTACTCGAGTAATATGATGAGGGTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-196s21c1
Sequence:CCGGATAACGAAGAACAGCGATATGCTCGAGCATATCGCTGTTCTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-744s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134048
VALIDATED
CBLL1 MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1628s1c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134048.1-83s1c1
Sequence:CCGGCCCTATAAAGCTCATCTCCAACTCGAGTTGGAGATGAGCTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-871s1c1
Sequence:CCGGGCAATTTAATAACGGTCCCTACTCGAGTAGGGACCGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-1268s1c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134048.1-872s1c1
Sequence:CCGGCAATTTAATAACGGTCCCTATCTCGAGATAGGGACCGTTATTAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134048.1-1268s21c1
Sequence:CCGGCCATTACAATCCTAACTCTTTCTCGAGAAAGAGTTAGGATTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134048.1-1628s21c1
Sequence:CCGGGCTTTCAAGTACTATTCTGTACTCGAGTACAGAATAGTACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-985s21c1
Sequence:CCGGTATCTCACCCTCATCATATTACTCGAGTAATATGATGAGGGTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-196s21c1
Sequence:CCGGATAACGAAGAACAGCGATATGCTCGAGCATATCGCTGTTCTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134048.1-744s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024814
VALIDATED
CBLL1 MISSION shRNA Bacterial Glycerol Stock
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-969s1c1
Sequence:CCGGGCTCACCATCATCCTGAATATCTCGAGATATTCAGGATGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-573s1c1
Sequence:CCGGGCTCATATCAACCATCGCCATCTCGAGATGGCGATGGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-1472s1c1
Sequence:CCGGGACAAGATATAGACCGTATTACTCGAGTAATACGGTCTATATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-110s1c1
Sequence:CCGGGCTCATCTCCAAACAAGCAAACTCGAGTTTGCTTGTTTGGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-892s1c1
Sequence:CCGGGCAATTTAATAACCGTCCCTACTCGAGTAGGGACGGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1507s21c1
Sequence:CCGGGCCCAGATGCCACCTTATATGCTCGAGCATATAAGGTGGCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-882s21c1
Sequence:CCGGTCATATCAACCATCGCCATATCTCGAGATATGGCGATGGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-1898s21c1
Sequence:CCGGCTCTTATCGAGGTAGTATAAACTCGAGTTTATACTACCTCGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-660s21c1
Sequence:CCGGCAAGTGTGGATTGCCTATTAACTCGAGTTAATAGGCAATCCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-1072s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1789s21c1
Sequence:CCGGAGACCGTATTACCAATGATAACTCGAGTTATCATTGGTAATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1163s21c1
Sequence:CCGGGTCAGGAAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-2007s21c1
Sequence:CCGGCAGTTGAGCACAGCTATATTTCTCGAGAAATATAGCTGTGCTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024814
VALIDATED
CBLL1 MISSION shRNA shRNA Plasmid DNA
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-969s1c1
Sequence:CCGGGCTCACCATCATCCTGAATATCTCGAGATATTCAGGATGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-573s1c1
Sequence:CCGGGCTCATATCAACCATCGCCATCTCGAGATGGCGATGGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-1472s1c1
Sequence:CCGGGACAAGATATAGACCGTATTACTCGAGTAATACGGTCTATATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-110s1c1
Sequence:CCGGGCTCATCTCCAAACAAGCAAACTCGAGTTTGCTTGTTTGGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-892s1c1
Sequence:CCGGGCAATTTAATAACCGTCCCTACTCGAGTAGGGACGGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1507s21c1
Sequence:CCGGGCCCAGATGCCACCTTATATGCTCGAGCATATAAGGTGGCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-882s21c1
Sequence:CCGGTCATATCAACCATCGCCATATCTCGAGATATGGCGATGGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-1898s21c1
Sequence:CCGGCTCTTATCGAGGTAGTATAAACTCGAGTTTATACTACCTCGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-660s21c1
Sequence:CCGGCAAGTGTGGATTGCCTATTAACTCGAGTTAATAGGCAATCCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-1072s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1789s21c1
Sequence:CCGGAGACCGTATTACCAATGATAACTCGAGTTATCATTGGTAATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1163s21c1
Sequence:CCGGGTCAGGAAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-2007s21c1
Sequence:CCGGCAGTTGAGCACAGCTATATTTCTCGAGAAATATAGCTGTGCTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024814
VALIDATED
CBLL1 MISSION shRNA Lentiviral Transduction Particles
Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-969s1c1
Sequence:CCGGGCTCACCATCATCCTGAATATCTCGAGATATTCAGGATGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-573s1c1
Sequence:CCGGGCTCATATCAACCATCGCCATCTCGAGATGGCGATGGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-1472s1c1
Sequence:CCGGGACAAGATATAGACCGTATTACTCGAGTAATACGGTCTATATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024814.1-110s1c1
Sequence:CCGGGCTCATCTCCAAACAAGCAAACTCGAGTTTGCTTGTTTGGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024814.1-892s1c1
Sequence:CCGGGCAATTTAATAACCGTCCCTACTCGAGTAGGGACGGTTATTAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1507s21c1
Sequence:CCGGGCCCAGATGCCACCTTATATGCTCGAGCATATAAGGTGGCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-882s21c1
Sequence:CCGGTCATATCAACCATCGCCATATCTCGAGATATGGCGATGGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-1898s21c1
Sequence:CCGGCTCTTATCGAGGTAGTATAAACTCGAGTTTATACTACCTCGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-660s21c1
Sequence:CCGGCAAGTGTGGATTGCCTATTAACTCGAGTTAATAGGCAATCCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024814.2-1072s21c1
Sequence:CCGGGTGCCACATGAGCACTATAATCTCGAGATTATAGTGCTCATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1789s21c1
Sequence:CCGGAGACCGTATTACCAATGATAACTCGAGTTATCATTGGTAATACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024814.2-1163s21c1
Sequence:CCGGGTCAGGAAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024814.2-2007s21c1
Sequence:CCGGCAGTTGAGCACAGCTATATTTCTCGAGAAATATAGCTGTGCTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks