EMAIL THIS PAGE TO A FRIEND

CBLN1

cerebellin 1 precursor

61 Gene Product Result for
UniProtKB ID: P23435, B2RAN9, P02682, Q52M09
Gene ID:
Human(869) Summary: This gene encodes a cerebellum-specific precursor protein, precerebellin, with similarity to the globular (non-collagen-like) domain of complement component C1qB. Precerebellin is processed to give rise to several derivatives, including the hexadecapeptide, cerebellin, which is highly enriched in postsynaptic structures of Purkinje cells. Cerebellin has also been found in human and rat adrenals, where it has been shown to enhance the secretory activity of this gland. [provided by RefSeq, Aug 2008]
Mouse(12404) cerebellin 1 precursor protein
Rat(498922) cerebellin 1 precursor
sheep(101111385) cerebellin 1 precursor
domestic guinea pig(100725337) cerebellin 1 precursor
naked mole-rat(101716138) cerebellin 1 precursor
Zebrafish(436793) cerebellin 1 precursor
cow(618604) cerebellin 1 precursor
chicken(771265) cerebellin 1 precursor
domestic cat(101093481) cerebellin 1 precursor
dog(611712) cerebellin 1 precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004352 Rosetta Predictions human pricing
NM_001109127 Rosetta Predictions rat pricing
NM_019626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085453 predicted 695
2 SASI_Hs01_00085454 predicted 634
3 SASI_Hs01_00085455 predicted 774
4 SASI_Hs01_00085456 predicted 980
5 SASI_Hs01_00085457 predicted 1007
6 SASI_Hs01_00085458 predicted 804
7 SASI_Hs01_00085459 predicted 632
8 SASI_Hs01_00085460 predicted 1049
9 SASI_Hs01_00085461 predicted 676
10 SASI_Hs01_00085462 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245390 predicted 738
2 SASI_Rn02_00245391 predicted 276
3 SASI_Rn02_00245392 predicted 274
4 SASI_Rn02_00245393 predicted 896
5 SASI_Rn02_00245394 predicted 249
6 SASI_Rn02_00245395 predicted 232
7 SASI_Rn02_00245396 predicted 882
8 SASI_Rn02_00245397 predicted 883
9 SASI_Rn02_00245398 predicted 937
10 SASI_Rn02_00245399 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089516 predicted 1098
2 SASI_Mm01_00089517 predicted 624
3 SASI_Mm01_00089518 predicted 629
4 SASI_Mm01_00089519 predicted 733
5 SASI_Mm01_00089520 predicted 1229
6 SASI_Mm01_00089521 predicted 1230
7 SASI_Mm01_00089522 predicted 1235
8 SASI_Mm01_00089523 predicted 1233
9 SASI_Mm01_00089524 predicted 1296
10 SASI_Mm01_00089525 predicted 1284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004352
CBLN1 MISSION shRNA Bacterial Glycerol Stock
cerebellin 1 precursor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004352.2-987s21c1
Sequence:CCGGGAAATTAAGAGGGCGAGAAAGCTCGAGCTTTCTCGCCCTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-585s1c1
Sequence:CCGGGTGAACATTGGGAACAACTTTCTCGAGAAAGTTGTTCCCAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-605s1c1
Sequence:CCGGTGATTCAGAACGCAGCACTTTCTCGAGAAAGTGCTGCGTTCTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-783s1c1
Sequence:CCGGGTCCTAATCCAAATGGAGAAACTCGAGTTTCTCCATTTGGATTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-542s1c1
Sequence:CCGGGATGAGTAATCGCACCATGATCTCGAGATCATGGTGCGATTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-770s1c1
Sequence:CCGGCGCCAGCAACGGAGTCCTAATCTCGAGATTAGGACTCCGTTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004352
CBLN1 MISSION shRNA shRNA Plasmid DNA
cerebellin 1 precursor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004352.2-987s21c1
Sequence:CCGGGAAATTAAGAGGGCGAGAAAGCTCGAGCTTTCTCGCCCTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-585s1c1
Sequence:CCGGGTGAACATTGGGAACAACTTTCTCGAGAAAGTTGTTCCCAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-605s1c1
Sequence:CCGGTGATTCAGAACGCAGCACTTTCTCGAGAAAGTGCTGCGTTCTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-783s1c1
Sequence:CCGGGTCCTAATCCAAATGGAGAAACTCGAGTTTCTCCATTTGGATTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-542s1c1
Sequence:CCGGGATGAGTAATCGCACCATGATCTCGAGATCATGGTGCGATTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-770s1c1
Sequence:CCGGCGCCAGCAACGGAGTCCTAATCTCGAGATTAGGACTCCGTTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004352
CBLN1 MISSION shRNA Lentiviral Transduction Particles
cerebellin 1 precursor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004352.2-987s21c1
Sequence:CCGGGAAATTAAGAGGGCGAGAAAGCTCGAGCTTTCTCGCCCTCTTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-585s1c1
Sequence:CCGGGTGAACATTGGGAACAACTTTCTCGAGAAAGTTGTTCCCAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-605s1c1
Sequence:CCGGTGATTCAGAACGCAGCACTTTCTCGAGAAAGTGCTGCGTTCTGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-783s1c1
Sequence:CCGGGTCCTAATCCAAATGGAGAAACTCGAGTTTCTCCATTTGGATTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-542s1c1
Sequence:CCGGGATGAGTAATCGCACCATGATCTCGAGATCATGGTGCGATTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004352.1-770s1c1
Sequence:CCGGCGCCAGCAACGGAGTCCTAATCTCGAGATTAGGACTCCGTTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019626
CBLN1 MISSION shRNA Bacterial Glycerol Stock
cerebellin 1 precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-416s1c1
Sequence:CCGGAGTCTACAACAGACAGACCATCTCGAGATGGTCTGTCTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-281s1c1
Sequence:CCGGCGAGATGAGTAATCGCACCATCTCGAGATGGTGCGATTACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019626.2-939s1c1
Sequence:CCGGCCCTAACAATTAACGAAGTAACTCGAGTTACTTCGTTAATTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-608s1c1
Sequence:CCGGCTTCTCTGGATTCCTCGTGTTCTCGAGAACACGAGGAATCCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-335s1c1
Sequence:CCGGCGGGAACAACTTTGACTCAGACTCGAGTCTGAGTCAAAGTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019626
CBLN1 MISSION shRNA shRNA Plasmid DNA
cerebellin 1 precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-416s1c1
Sequence:CCGGAGTCTACAACAGACAGACCATCTCGAGATGGTCTGTCTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-281s1c1
Sequence:CCGGCGAGATGAGTAATCGCACCATCTCGAGATGGTGCGATTACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019626.2-939s1c1
Sequence:CCGGCCCTAACAATTAACGAAGTAACTCGAGTTACTTCGTTAATTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-608s1c1
Sequence:CCGGCTTCTCTGGATTCCTCGTGTTCTCGAGAACACGAGGAATCCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-335s1c1
Sequence:CCGGCGGGAACAACTTTGACTCAGACTCGAGTCTGAGTCAAAGTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019626
CBLN1 MISSION shRNA Lentiviral Transduction Particles
cerebellin 1 precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-416s1c1
Sequence:CCGGAGTCTACAACAGACAGACCATCTCGAGATGGTCTGTCTGTTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-281s1c1
Sequence:CCGGCGAGATGAGTAATCGCACCATCTCGAGATGGTGCGATTACTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019626.2-939s1c1
Sequence:CCGGCCCTAACAATTAACGAAGTAACTCGAGTTACTTCGTTAATTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-608s1c1
Sequence:CCGGCTTCTCTGGATTCCTCGTGTTCTCGAGAACACGAGGAATCCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019626.2-335s1c1
Sequence:CCGGCGGGAACAACTTTGACTCAGACTCGAGTCTGAGTCAAAGTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks