EMAIL THIS PAGE TO A FRIEND

CBLN2

cerebellin 2 precursor

94 Gene Product Result for
UniProtKB ID: Q8IUK8, Q53Z56
Gene ID:
Mouse(12405) cerebellin 2 precursor protein
Rat(291388) cerebellin 2 precursor
chicken(421019) cerebellin 2
domestic cat(101098260) cerebellin 2 precursor
cow(509847) cerebellin 2 precursor
naked mole-rat(101714119) cerebellin 2 precursor
domestic guinea pig(100712813) cerebellin 2 precursor
sheep(101112017) cerebellin 2 precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023611 MISSION® esiRNA esiRNA targeting mouse Cbln2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182511 Rosetta Predictions human pricing
NM_001012740 Rosetta Predictions rat pricing
NM_172633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078760 predicted 1143
2 SASI_Hs01_00078761 predicted 1061
3 SASI_Hs01_00078762 predicted 1092
4 SASI_Hs01_00078764 predicted 1165
5 SASI_Hs01_00078765 predicted 1255
6 SASI_Hs01_00078766 predicted 1305
7 SASI_Hs01_00078767 predicted 1772
8 SASI_Hs01_00078768 predicted 1188
9 SASI_Hs01_00078769 predicted 1286
10 SASI_Hs02_00370585 predicted 1782
11 SASI_Hs01_00078763 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107389 predicted 644
2 SASI_Rn01_00107390 predicted 637
3 SASI_Rn01_00107391 predicted 1132
4 SASI_Rn01_00107393 predicted 1151
5 SASI_Rn01_00107394 predicted 1072
6 SASI_Rn01_00107395 predicted 918
7 SASI_Rn01_00107396 predicted 1144
8 SASI_Rn01_00107397 predicted 550
9 SASI_Rn02_00200598 predicted 1093
10 SASI_Rn02_00200599 predicted 557
11 SASI_Rn01_00107392 predicted 1080
12 SASI_Rn01_00107398 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158940 predicted 992
2 SASI_Mm01_00158941 predicted 429
3 SASI_Mm01_00158942 predicted 483
4 SASI_Mm01_00158943 predicted 363
5 SASI_Mm01_00158944 predicted 756
6 SASI_Mm01_00158945 predicted 916
7 SASI_Mm01_00158946 predicted 757
8 SASI_Mm01_00158947 predicted 398
9 SASI_Mm01_00158948 predicted 978
10 SASI_Mm01_00158949 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182511
CBLN2 MISSION shRNA Bacterial Glycerol Stock
cerebellin 2 precursor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182511.2-1504s1c1
Sequence:CCGGCCTGTGATTGTAAAGTCAATACTCGAGTATTGACTTTACAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182511.2-2504s1c1
Sequence:CCGGGCACTGTTACAAATCCTTCTTCTCGAGAAGAAGGATTTGTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-1146s1c1
Sequence:CCGGGAAGACAAAGTGCATCTCAAACTCGAGTTTGAGATGCACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-961s1c1
Sequence:CCGGGTATATTTGTAGCACCGAGAACTCGAGTTCTCGGTGCTACAAATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-944s1c1
Sequence:CCGGCTTTGATCTTGCTTCCAGTATCTCGAGATACTGGAAGCAAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182511.3-1073s21c1
Sequence:CCGGTCGACCAGGTATTAGTAAATACTCGAGTATTTACTAATACCTGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182511
CBLN2 MISSION shRNA shRNA Plasmid DNA
cerebellin 2 precursor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182511.2-1504s1c1
Sequence:CCGGCCTGTGATTGTAAAGTCAATACTCGAGTATTGACTTTACAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182511.2-2504s1c1
Sequence:CCGGGCACTGTTACAAATCCTTCTTCTCGAGAAGAAGGATTTGTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-1146s1c1
Sequence:CCGGGAAGACAAAGTGCATCTCAAACTCGAGTTTGAGATGCACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-961s1c1
Sequence:CCGGGTATATTTGTAGCACCGAGAACTCGAGTTCTCGGTGCTACAAATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-944s1c1
Sequence:CCGGCTTTGATCTTGCTTCCAGTATCTCGAGATACTGGAAGCAAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182511.3-1073s21c1
Sequence:CCGGTCGACCAGGTATTAGTAAATACTCGAGTATTTACTAATACCTGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182511
CBLN2 MISSION shRNA Lentiviral Transduction Particles
cerebellin 2 precursor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182511.2-1504s1c1
Sequence:CCGGCCTGTGATTGTAAAGTCAATACTCGAGTATTGACTTTACAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182511.2-2504s1c1
Sequence:CCGGGCACTGTTACAAATCCTTCTTCTCGAGAAGAAGGATTTGTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-1146s1c1
Sequence:CCGGGAAGACAAAGTGCATCTCAAACTCGAGTTTGAGATGCACTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-961s1c1
Sequence:CCGGGTATATTTGTAGCACCGAGAACTCGAGTTCTCGGTGCTACAAATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182511.2-944s1c1
Sequence:CCGGCTTTGATCTTGCTTCCAGTATCTCGAGATACTGGAAGCAAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182511.3-1073s21c1
Sequence:CCGGTCGACCAGGTATTAGTAAATACTCGAGTATTTACTAATACCTGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172633
CBLN2 MISSION shRNA Bacterial Glycerol Stock
cerebellin 2 precursor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172633.1-951s1c1
Sequence:CCGGCCCGTGATTGTAAAGTCGATACTCGAGTATCGACTTTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-374s1c1
Sequence:CCGGGACCAGGTCTTAGTAAACATTCTCGAGAATGTTTACTAAGACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-417s1c1
Sequence:CCGGCCAGTATATTTGTAGCACCAACTCGAGTTGGTGCTACAAATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-352s1c1
Sequence:CCGGCCGTACCATGACCATCTACTTCTCGAGAAGTAGATGGTCATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172633
CBLN2 MISSION shRNA shRNA Plasmid DNA
cerebellin 2 precursor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172633.1-951s1c1
Sequence:CCGGCCCGTGATTGTAAAGTCGATACTCGAGTATCGACTTTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-374s1c1
Sequence:CCGGGACCAGGTCTTAGTAAACATTCTCGAGAATGTTTACTAAGACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-417s1c1
Sequence:CCGGCCAGTATATTTGTAGCACCAACTCGAGTTGGTGCTACAAATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-352s1c1
Sequence:CCGGCCGTACCATGACCATCTACTTCTCGAGAAGTAGATGGTCATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172633
CBLN2 MISSION shRNA Lentiviral Transduction Particles
cerebellin 2 precursor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172633.1-951s1c1
Sequence:CCGGCCCGTGATTGTAAAGTCGATACTCGAGTATCGACTTTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-374s1c1
Sequence:CCGGGACCAGGTCTTAGTAAACATTCTCGAGAATGTTTACTAAGACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-417s1c1
Sequence:CCGGCCAGTATATTTGTAGCACCAACTCGAGTTGGTGCTACAAATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172633.1-352s1c1
Sequence:CCGGCCGTACCATGACCATCTACTTCTCGAGAAGTAGATGGTCATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks