EMAIL THIS PAGE TO A FRIEND

CBLN3

cerebellin 3 precursor

146 Gene Product Result for
Synonyms: PRO1486
UniProtKB ID: Q6UW01
Gene ID:
Human(643866) Summary: Members of the precerebellin family, such as CBLN3, contain a cerebellin motif (see CBLN1; MIM 600432) and a C-terminal C1q signature domain (see MIM 120550) that mediates trimeric assembly of atypical collagen complexes. However, precerebellins do not contain a collagen motif, suggesting that they are not conventional components of the extracellular matrix (Pang et al., 2000 [PubMed 10964938]
Mouse(56410) cerebellin 3 precursor protein
Rat(501998) cerebellin 3 precursor
cow(529166) cerebellin 3 precursor
domestic cat(101084032) cerebellin 3 precursor
dog(490626) cerebellin 3 precursor
sheep(101112982) cerebellin 3 precursor
domestic guinea pig(100731121) cerebellin 3 precursor
naked mole-rat(101717158) cerebellin 3 precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041266 Anti-CBLN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502755 Anti-CBLN3, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039771 Rosetta Predictions human pricing
NM_001109330 Rosetta Predictions rat pricing
NM_019820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234171 predicted 1216
2 SASI_Hs01_00234172 predicted 1421
3 SASI_Hs01_00234173 predicted 883
4 SASI_Hs01_00234174 predicted 685
5 SASI_Hs02_00308669 predicted 1095
6 SASI_Hs01_00234177 predicted 1033
7 SASI_Hs01_00234178 predicted 1223
8 SASI_Hs01_00234179 predicted 525
9 SASI_Hs01_00234180 predicted 772
10 SASI_Hs02_00308670 predicted 964
11 SASI_Hs01_00234175 predicted 1567
12 SASI_Hs01_00234176 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247364 predicted 949
2 SASI_Rn02_00247365 predicted 785
3 SASI_Rn02_00247366 predicted 482
4 SASI_Rn02_00247367 predicted 623
5 SASI_Rn02_00247368 predicted 789
6 SASI_Rn02_00247369 predicted 1087
7 SASI_Rn02_00247370 predicted 387
8 SASI_Rn02_00247371 predicted 1101
9 SASI_Rn02_00247372 predicted 424
10 SASI_Rn02_00247373 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325102 predicted 1071
2 SASI_Mm02_00325103 predicted 814
3 SASI_Mm02_00325104 predicted 252
4 SASI_Mm02_00325105 predicted 462
5 SASI_Mm02_00325106 predicted 349
6 SASI_Mm02_00325107 predicted 298
7 SASI_Mm02_00325108 predicted 444
8 SASI_Mm02_00325109 predicted 780
9 SASI_Mm02_00325110 predicted 311
10 SASI_Mm02_00325111 predicted 1006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039771
CBLN3 MISSION shRNA Bacterial Glycerol Stock
cerebellin 3 precursor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1031s21c1
Sequence:CCGGATCTACTGGGTGGTTGGAAATCTCGAGATTTCCAACCACCCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-864s21c1
Sequence:CCGGGAAGGTGTACAACCGCCAAACCTCGAGGTTTGGCGGTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039771.2-2177s21c1
Sequence:CCGGGCCTGGATGAATCTATCAATACTCGAGTATTGATAGATTCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1084s21c1
Sequence:CCGGCTCTGAGGACCCAAGTCTTTCCTCGAGGAAAGACTTGGGTCCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-839s21c1
Sequence:CCGGTCTACAGCTTCCGGTTCCATGCTCGAGCATGGAACCGGAAGCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039771
CBLN3 MISSION shRNA shRNA Plasmid DNA
cerebellin 3 precursor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1031s21c1
Sequence:CCGGATCTACTGGGTGGTTGGAAATCTCGAGATTTCCAACCACCCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-864s21c1
Sequence:CCGGGAAGGTGTACAACCGCCAAACCTCGAGGTTTGGCGGTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039771.2-2177s21c1
Sequence:CCGGGCCTGGATGAATCTATCAATACTCGAGTATTGATAGATTCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1084s21c1
Sequence:CCGGCTCTGAGGACCCAAGTCTTTCCTCGAGGAAAGACTTGGGTCCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-839s21c1
Sequence:CCGGTCTACAGCTTCCGGTTCCATGCTCGAGCATGGAACCGGAAGCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039771
CBLN3 MISSION shRNA Lentiviral Transduction Particles
cerebellin 3 precursor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1031s21c1
Sequence:CCGGATCTACTGGGTGGTTGGAAATCTCGAGATTTCCAACCACCCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-864s21c1
Sequence:CCGGGAAGGTGTACAACCGCCAAACCTCGAGGTTTGGCGGTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039771.2-2177s21c1
Sequence:CCGGGCCTGGATGAATCTATCAATACTCGAGTATTGATAGATTCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-1084s21c1
Sequence:CCGGCTCTGAGGACCCAAGTCTTTCCTCGAGGAAAGACTTGGGTCCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039771.2-839s21c1
Sequence:CCGGTCTACAGCTTCCGGTTCCATGCTCGAGCATGGAACCGGAAGCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019820
CBLN3 MISSION shRNA Bacterial Glycerol Stock
cerebellin 3 precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019820.2-1405s1c1
Sequence:CCGGGCAGAGTCAAAGGTCACGAATCTCGAGATTCGTGACCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-502s1c1
Sequence:CCGGGCCTTTGCAAATGACCCTGATCTCGAGATCAGGGTCATTTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-408s1c1
Sequence:CCGGTGGAGTCTACAGCTTCCGATTCTCGAGAATCGGAAGCTGTAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-467s1c1
Sequence:CCGGTGAGTCTGATGCTGAACACATCTCGAGATGTGTTCAGCATCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-617s1c1
Sequence:CCGGGCTGGAAGTATTCGAGCTTCTCTCGAGAGAAGCTCGAATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019820
CBLN3 MISSION shRNA shRNA Plasmid DNA
cerebellin 3 precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019820.2-1405s1c1
Sequence:CCGGGCAGAGTCAAAGGTCACGAATCTCGAGATTCGTGACCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-502s1c1
Sequence:CCGGGCCTTTGCAAATGACCCTGATCTCGAGATCAGGGTCATTTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-408s1c1
Sequence:CCGGTGGAGTCTACAGCTTCCGATTCTCGAGAATCGGAAGCTGTAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-467s1c1
Sequence:CCGGTGAGTCTGATGCTGAACACATCTCGAGATGTGTTCAGCATCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-617s1c1
Sequence:CCGGGCTGGAAGTATTCGAGCTTCTCTCGAGAGAAGCTCGAATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019820
CBLN3 MISSION shRNA Lentiviral Transduction Particles
cerebellin 3 precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019820.2-1405s1c1
Sequence:CCGGGCAGAGTCAAAGGTCACGAATCTCGAGATTCGTGACCTTTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-502s1c1
Sequence:CCGGGCCTTTGCAAATGACCCTGATCTCGAGATCAGGGTCATTTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-408s1c1
Sequence:CCGGTGGAGTCTACAGCTTCCGATTCTCGAGAATCGGAAGCTGTAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-467s1c1
Sequence:CCGGTGAGTCTGATGCTGAACACATCTCGAGATGTGTTCAGCATCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019820.2-617s1c1
Sequence:CCGGGCTGGAAGTATTCGAGCTTCTCTCGAGAGAAGCTCGAATACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks