EMAIL THIS PAGE TO A FRIEND

CBLN4

cerebellin 4 precursor

103 Gene Product Result for
Synonyms: CBLNL1
UniProtKB ID: Q9NTU7, A8K0S5
Gene ID:
Human(140689) Summary: This gene encodes a member of a family of small secreted proteins containing C1Q domains. Members of this family are involved in regulation of neurexin signalling during synapse development. The mouse homolog of the protein encoded by this gene competes with netrin to bind to the deleted in colorectal cancer receptor. [provided by RefSeq, Aug 2012]
Mouse(228942) cerebellin 4 precursor protein
Rat(499947) cerebellin 4 precursor
domestic guinea pig(100727185) cerebellin 4 precursor
sheep(101102832) cerebellin 4 precursor
Zebrafish(563847) cerebellin 4 precursor
chicken(769254) cerebellin 4 precursor
cow(539114) cerebellin 4 precursor
domestic cat(101091684) cerebellin 4 precursor
dog(611731) cerebellin 4 precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52505 Anti-CBLN4 antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, mouse, horse, guinea pig, human, rat, bovine, pig
western blot pricing
SAB4300765 Anti-CBLN4 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4500477 Anti-CBLN4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080617 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077441 MISSION® esiRNA esiRNA targeting mouse Cbln4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080617 Rosetta Predictions human pricing
NM_001109210 Rosetta Predictions rat pricing
NM_175631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032949 predicted 1184
2 SASI_Hs01_00032950 predicted 1496
3 SASI_Hs01_00032951 predicted 1523
4 SASI_Hs01_00032952 predicted 1594
5 SASI_Hs01_00032953 predicted 1608
6 SASI_Hs01_00032954 predicted 1169
7 SASI_Hs01_00032955 predicted 1043
8 SASI_Hs01_00032956 predicted 1578
9 SASI_Hs01_00032957 predicted 1023
10 SASI_Hs01_00032958 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246170 predicted 1420
2 SASI_Rn02_00246171 predicted 1686
3 SASI_Rn02_00246172 predicted 1511
4 SASI_Rn02_00246173 predicted 1196
5 SASI_Rn02_00246174 predicted 1684
6 SASI_Rn02_00246175 predicted 1556
7 SASI_Rn02_00246176 predicted 1985
8 SASI_Rn02_00246177 predicted 1864
9 SASI_Rn02_00246178 predicted 1601
10 SASI_Rn02_00246179 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346556 predicted 1621
2 SASI_Mm01_00176249 predicted 1415
3 SASI_Mm02_00346557 predicted 1650
4 SASI_Mm02_00346558 predicted 1504
5 SASI_Mm02_00346559 predicted 1229
6 SASI_Mm01_00176252 predicted 1634
7 SASI_Mm02_00346560 predicted 1544
8 SASI_Mm01_00176253 predicted 1665
9 SASI_Mm02_00346561 predicted 1557
10 SASI_Mm01_00176255 predicted 1349
11 SASI_Mm01_00176250 predicted 1904
12 SASI_Mm01_00176251 predicted 1955
13 SASI_Mm01_00176254 predicted 2029
14 SASI_Mm01_00176256 predicted 1999
15 SASI_Mm01_00176257 predicted 1613
16 SASI_Mm01_00176258 predicted 1947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175631
CBLN4 MISSION shRNA Bacterial Glycerol Stock
cerebellin 4 precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175631.1-2652s1c1
Sequence:CCGGCCACTTTATTAACTGGAGATACTCGAGTATCTCCAGTTAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1619s1c1
Sequence:CCGGGATAAAGATGTGACCCGTGAACTCGAGTTCACGGGTCACATCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1567s1c1
Sequence:CCGGCCAGGTTAACTTGATGTTAAACTCGAGTTTAACATCAAGTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1502s1c1
Sequence:CCGGGCACCGAGGAAAGGAATCTATCTCGAGATAGATTCCTTTCCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1422s1c1
Sequence:CCGGGCAACAAGACTCGCATCATTTCTCGAGAAATGATGCGAGTCTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175631
CBLN4 MISSION shRNA shRNA Plasmid DNA
cerebellin 4 precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175631.1-2652s1c1
Sequence:CCGGCCACTTTATTAACTGGAGATACTCGAGTATCTCCAGTTAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1619s1c1
Sequence:CCGGGATAAAGATGTGACCCGTGAACTCGAGTTCACGGGTCACATCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1567s1c1
Sequence:CCGGCCAGGTTAACTTGATGTTAAACTCGAGTTTAACATCAAGTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1502s1c1
Sequence:CCGGGCACCGAGGAAAGGAATCTATCTCGAGATAGATTCCTTTCCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1422s1c1
Sequence:CCGGGCAACAAGACTCGCATCATTTCTCGAGAAATGATGCGAGTCTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175631
CBLN4 MISSION shRNA Lentiviral Transduction Particles
cerebellin 4 precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175631.1-2652s1c1
Sequence:CCGGCCACTTTATTAACTGGAGATACTCGAGTATCTCCAGTTAATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1619s1c1
Sequence:CCGGGATAAAGATGTGACCCGTGAACTCGAGTTCACGGGTCACATCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1567s1c1
Sequence:CCGGCCAGGTTAACTTGATGTTAAACTCGAGTTTAACATCAAGTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1502s1c1
Sequence:CCGGGCACCGAGGAAAGGAATCTATCTCGAGATAGATTCCTTTCCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175631.1-1422s1c1
Sequence:CCGGGCAACAAGACTCGCATCATTTCTCGAGAAATGATGCGAGTCTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080617
CBLN4 MISSION shRNA Bacterial Glycerol Stock
cerebellin 4 precursor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-248s1c1
Sequence:CCGGCATCCGAGATGAGCAACAAGACTCGAGTCTTGTTGCTCATCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-264s1c1
Sequence:CCGGCAAGACGCGCATCATTTACTTCTCGAGAAGTAAATGATGCGCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-285s1c1
Sequence:CCGGCGATCAGATCCTGGTGAATGTCTCGAGACATTCACCAGGATCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-538s1c1
Sequence:CCGGGAGAAAGGTAATTTGGTTGGACTCGAGTCCAACCAAATTACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-457s1c1
Sequence:CCGGGACAAAGATGTTACTCGTGAACTCGAGTTCACGAGTAACATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-270s1c1
Sequence:CCGGGCGCATCATTTACTTCGATCACTCGAGTGATCGAAGTAAATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-393s1c1
Sequence:CCGGGAGCCAAACTATCCAGGTTAACTCGAGTTAACCTGGATAGTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-378s1c1
Sequence:CCGGGATTAAAGTCTACCAGAGCCACTCGAGTGGCTCTGGTAGACTTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-493s1c1
Sequence:CCGGGTCCTGCTCTACCTAGATAAACTCGAGTTTATCTAGGTAGAGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-329s1c1
Sequence:CCGGCTGTCTTTGTAGCACCAAGAACTCGAGTTCTTGGTGCTACAAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080617
CBLN4 MISSION shRNA shRNA Plasmid DNA
cerebellin 4 precursor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-248s1c1
Sequence:CCGGCATCCGAGATGAGCAACAAGACTCGAGTCTTGTTGCTCATCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-264s1c1
Sequence:CCGGCAAGACGCGCATCATTTACTTCTCGAGAAGTAAATGATGCGCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-285s1c1
Sequence:CCGGCGATCAGATCCTGGTGAATGTCTCGAGACATTCACCAGGATCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-538s1c1
Sequence:CCGGGAGAAAGGTAATTTGGTTGGACTCGAGTCCAACCAAATTACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-457s1c1
Sequence:CCGGGACAAAGATGTTACTCGTGAACTCGAGTTCACGAGTAACATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-270s1c1
Sequence:CCGGGCGCATCATTTACTTCGATCACTCGAGTGATCGAAGTAAATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-393s1c1
Sequence:CCGGGAGCCAAACTATCCAGGTTAACTCGAGTTAACCTGGATAGTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-378s1c1
Sequence:CCGGGATTAAAGTCTACCAGAGCCACTCGAGTGGCTCTGGTAGACTTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-493s1c1
Sequence:CCGGGTCCTGCTCTACCTAGATAAACTCGAGTTTATCTAGGTAGAGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-329s1c1
Sequence:CCGGCTGTCTTTGTAGCACCAAGAACTCGAGTTCTTGGTGCTACAAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080617
CBLN4 MISSION shRNA Lentiviral Transduction Particles
cerebellin 4 precursor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-248s1c1
Sequence:CCGGCATCCGAGATGAGCAACAAGACTCGAGTCTTGTTGCTCATCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-264s1c1
Sequence:CCGGCAAGACGCGCATCATTTACTTCTCGAGAAGTAAATGATGCGCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-285s1c1
Sequence:CCGGCGATCAGATCCTGGTGAATGTCTCGAGACATTCACCAGGATCTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-538s1c1
Sequence:CCGGGAGAAAGGTAATTTGGTTGGACTCGAGTCCAACCAAATTACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-457s1c1
Sequence:CCGGGACAAAGATGTTACTCGTGAACTCGAGTTCACGAGTAACATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-270s1c1
Sequence:CCGGGCGCATCATTTACTTCGATCACTCGAGTGATCGAAGTAAATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-393s1c1
Sequence:CCGGGAGCCAAACTATCCAGGTTAACTCGAGTTAACCTGGATAGTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080617.3-378s1c1
Sequence:CCGGGATTAAAGTCTACCAGAGCCACTCGAGTGGCTCTGGTAGACTTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-493s1c1
Sequence:CCGGGTCCTGCTCTACCTAGATAAACTCGAGTTTATCTAGGTAGAGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080617.3-329s1c1
Sequence:CCGGCTGTCTTTGTAGCACCAAGAACTCGAGTTCTTGGTGCTACAAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks