EMAIL THIS PAGE TO A FRIEND

CBR1

carbonyl reductase 1

57 Gene Product Result for
Synonyms: CBR SDR21C1 hCBR1
UniProtKB ID: P16152, B2RBZ7, Q3LHW8
Gene ID:
Human(873) Summary: Carbonyl reductase is one of several monomeric, NADPH-dependent oxidoreductases having wide specificity for carbonyl compounds. This enzyme is widely distributed in human tissues. Another carbonyl reductase gene, CRB3, lies close to this gene on chromosome 21q. [provided by RefSeq, Jul 2008]
Mouse(12408) carbonyl reductase 1
Rat(29224) carbonyl reductase 1
Zebrafish(373866) carbonyl reductase 1
cow(515946) carbonyl reductase 1
dog(610164) carbonyl reductase 1
chicken(418512) carbonyl reductase 1
domestic guinea pig(100723873) carbonyl reductase 1
Domestic Rabbit(100009528) carbonyl reductase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001757 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001757 Rosetta Predictions human pricing
NM_019170 Rosetta Predictions rat pricing
NM_007620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169813 predicted 523
2 SASI_Hs01_00169815 predicted 476
3 SASI_Hs01_00169816 predicted 495
4 SASI_Hs01_00169817 predicted 428
5 SASI_Hs01_00169818 predicted 478
6 SASI_Hs01_00169819 predicted 529
7 SASI_Hs01_00169820 predicted 522
8 SASI_Hs01_00169821 predicted 711
9 SASI_Hs01_00169822 predicted 413
10 SASI_Hs02_00332484 predicted 483
11 SASI_Hs01_00169814 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079200 predicted 579
2 SASI_Rn01_00079201 predicted 642
3 SASI_Rn01_00079202 predicted 352
4 SASI_Rn01_00079203 predicted 654
5 SASI_Rn01_00079205 predicted 407
6 SASI_Rn01_00079206 predicted 354
7 SASI_Rn01_00079207 predicted 410
8 SASI_Rn01_00079208 predicted 593
9 SASI_Rn02_00261958 predicted 355
10 SASI_Rn01_00079209 predicted 644
11 SASI_Rn01_00079204 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312073 predicted 752
2 SASI_Mm02_00312074 predicted 402
3 SASI_Mm01_00201487 predicted 666
4 SASI_Mm01_00201488 predicted 680
5 SASI_Mm01_00201489 predicted 682
6 SASI_Mm02_00312075 predicted 548
7 SASI_Mm01_00201490 predicted 677
8 SASI_Mm01_00201491 predicted 391
9 SASI_Mm02_00312076 predicted 686
10 SASI_Mm02_00312077 predicted 728
11 SASI_Mm01_00201492 predicted 339
12 SASI_Mm01_00201493 predicted 177
13 SASI_Mm01_00201494 predicted 997
14 SASI_Mm01_00201495 predicted 186
15 SASI_Mm01_00201496 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001757
VALIDATED
CBR1 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-397s1c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-460s1c1
Sequence:CCGGACAGAATTACTCCCTCTAATACTCGAGTATTAGAGGGAGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-898s1c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-885s1c1
Sequence:CCGGCCATGGACAATTTGTTTCAGACTCGAGTCTGAAACAAATTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-409s1c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-553s21c1
Sequence:CCGGATGAGCGTCAGAGCCCTTAAACTCGAGTTTAAGGGCTCTGACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-445s21c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-433s21c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-934s21c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001757.2-1023s21c1
Sequence:CCGGAGGGCATTTACAATGTCATAACTCGAGTTATGACATTGTAAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001757
VALIDATED
CBR1 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-397s1c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-460s1c1
Sequence:CCGGACAGAATTACTCCCTCTAATACTCGAGTATTAGAGGGAGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-898s1c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-885s1c1
Sequence:CCGGCCATGGACAATTTGTTTCAGACTCGAGTCTGAAACAAATTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-409s1c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-553s21c1
Sequence:CCGGATGAGCGTCAGAGCCCTTAAACTCGAGTTTAAGGGCTCTGACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-445s21c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-433s21c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-934s21c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001757.2-1023s21c1
Sequence:CCGGAGGGCATTTACAATGTCATAACTCGAGTTATGACATTGTAAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001757
VALIDATED
CBR1 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-397s1c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-460s1c1
Sequence:CCGGACAGAATTACTCCCTCTAATACTCGAGTATTAGAGGGAGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-898s1c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001757.1-885s1c1
Sequence:CCGGCCATGGACAATTTGTTTCAGACTCGAGTCTGAAACAAATTGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001757.1-409s1c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-553s21c1
Sequence:CCGGATGAGCGTCAGAGCCCTTAAACTCGAGTTTAAGGGCTCTGACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-445s21c1
Sequence:CCGGCAAGCTGAAGTGACGATGAAACTCGAGTTTCATCGTCACTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001757.2-433s21c1
Sequence:CCGGCCCTTTCATATTCAAGCTGAACTCGAGTTCAGCTTGAATATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001757.2-934s21c1
Sequence:CCGGGTTTCAGAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001757.2-1023s21c1
Sequence:CCGGAGGGCATTTACAATGTCATAACTCGAGTTATGACATTGTAAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007620
VALIDATED
CBR1 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-530s1c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-158s1c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-453s1c1
Sequence:CCGGGTGACAATGGAAACGAACTTTCTCGAGAAAGTTCGTTTCCATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-164s1c1
Sequence:CCGGTGCTAACAAAGGAATCGGATTCTCGAGAATCCGATTCCTTTGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-682s1c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-531s21c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-683s21c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-404s21c1
Sequence:CCGGGCATCGCCTTCAAGGTCAATGCTCGAGCATTGACCTTGAAGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-159s21c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-319s21c1
Sequence:CCGGATCGACAACCCGCAGAGCATTCTCGAGAATGCTCTGCGGGTTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007620
VALIDATED
CBR1 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-530s1c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-158s1c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-453s1c1
Sequence:CCGGGTGACAATGGAAACGAACTTTCTCGAGAAAGTTCGTTTCCATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-164s1c1
Sequence:CCGGTGCTAACAAAGGAATCGGATTCTCGAGAATCCGATTCCTTTGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-682s1c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-531s21c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-683s21c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-404s21c1
Sequence:CCGGGCATCGCCTTCAAGGTCAATGCTCGAGCATTGACCTTGAAGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-159s21c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-319s21c1
Sequence:CCGGATCGACAACCCGCAGAGCATTCTCGAGAATGCTCTGCGGGTTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007620
VALIDATED
CBR1 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-530s1c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-158s1c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-453s1c1
Sequence:CCGGGTGACAATGGAAACGAACTTTCTCGAGAAAGTTCGTTTCCATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-164s1c1
Sequence:CCGGTGCTAACAAAGGAATCGGATTCTCGAGAATCCGATTCCTTTGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007620.1-682s1c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-531s21c1
Sequence:CCGGAGTGGTGAATGTGTCCAGCATCTCGAGATGCTGGACACATTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-683s21c1
Sequence:CCGGCGGAAGAAGGTTGGCCTAATACTCGAGTATTAGGCCAACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-404s21c1
Sequence:CCGGGCATCGCCTTCAAGGTCAATGCTCGAGCATTGACCTTGAAGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-159s21c1
Sequence:CCGGGACCGGTGCTAACAAAGGAATCTCGAGATTCCTTTGTTAGCACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007620.2-319s21c1
Sequence:CCGGATCGACAACCCGCAGAGCATTCTCGAGAATGCTCTGCGGGTTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks