EMAIL THIS PAGE TO A FRIEND

CBR3

carbonyl reductase 3

61 Gene Product Result for
Synonyms: SDR21C2 hCBR3
UniProtKB ID: O75828, Q6FHP2
Gene ID:
Human(874) Summary: Carbonyl reductase 3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. The enzyme is classified as a monomeric NADPH-dependent oxidoreductase. CBR3 contains three exons spanning 11.2 kilobases and is closely linked to another carbonyl reductase gene - CBR1. [provided by RefSeq, Jul 2008]
Mouse(109857) carbonyl reductase 3
Rat(304078) carbonyl reductase 3
domestic guinea pig(100727088) carbonyl reductase 3
sheep(101115420) carbonyl reductase 3
dog(487748) carbonyl reductase 3
domestic cat(101082844) carbonyl reductase 3
cow(516036) carbonyl reductase 3
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001236 Rosetta Predictions human pricing
NM_001107110 Rosetta Predictions rat pricing
NM_173047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216513 predicted 724
2 SASI_Hs01_00216515 predicted 588
3 SASI_Hs01_00216516 predicted 589
4 SASI_Hs01_00216517 predicted 614
5 SASI_Hs01_00216518 predicted 501
6 SASI_Hs01_00216519 predicted 537
7 SASI_Hs01_00216520 predicted 468
8 SASI_Hs02_00331407 predicted 590
9 SASI_Hs02_00331408 predicted 408
10 SASI_Hs02_00331409 predicted 292
11 SASI_Hs01_00216514 predicted 869
12 SASI_Hs01_00216521 predicted 529
13 SASI_Hs01_00216522 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225596 predicted 413
2 SASI_Rn02_00225597 predicted 576
3 SASI_Rn02_00225598 predicted 705
4 SASI_Rn02_00225599 predicted 447
5 SASI_Rn02_00225600 predicted 747
6 SASI_Rn02_00225601 predicted 560
7 SASI_Rn02_00225602 predicted 925
8 SASI_Rn02_00225603 predicted 438
9 SASI_Rn02_00225604 predicted 410
10 SASI_Rn02_00225605 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100028 predicted 909
2 SASI_Mm01_00100029 predicted 408
3 SASI_Mm01_00100030 predicted 554
4 SASI_Mm01_00100031 predicted 580
5 SASI_Mm01_00100032 predicted 714
6 SASI_Mm01_00100033 predicted 549
7 SASI_Mm02_00345107 predicted 932
8 SASI_Mm01_00100034 predicted 417
9 SASI_Mm01_00100035 predicted 392
10 SASI_Mm01_00100036 predicted 919
11 SASI_Mm01_00100037 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001236
VALIDATED
CBR3 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-387s1c1
Sequence:CCGGGCAACGAGTTACTGCCGATAACTCGAGTTATCGGCAGTAACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-271s1c1
Sequence:CCGGGCTCAACGTACTGGTCAACAACTCGAGTTGTTGACCAGTACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-674s1c1
Sequence:CCGGGCTGACAGGATTCTGGTGAATCTCGAGATTCACCAGAATCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-303s1c1
Sequence:CCGGCCTTCAAGAGTGATGATCCAACTCGAGTTGGATCATCACTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001236.2-653s1c1
Sequence:CCGGCGTCTGGATGAGAAGAGGAAACTCGAGTTTCCTCTTCTCATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-594s21c1
Sequence:CCGGCAACGAGTTACTGCCGATAATCTCGAGATTATCGGCAGTAACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-881s21c1
Sequence:CCGGCTGACAGGATTCTGGTGAATGCTCGAGCATTCACCAGAATCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-525s21c1
Sequence:CCGGTCCAATGCCCTTTGACATTAACTCGAGTTAATGTCAAAGGGCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-622s21c1
Sequence:CCGGCATGGGAGAGTGGTGAATATCCTCGAGGATATTCACCACTCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-552s21c1
Sequence:CCGGGATGACACTGAAGACAAATTTCTCGAGAAATTTGTCTTCAGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001236
VALIDATED
CBR3 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-387s1c1
Sequence:CCGGGCAACGAGTTACTGCCGATAACTCGAGTTATCGGCAGTAACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-271s1c1
Sequence:CCGGGCTCAACGTACTGGTCAACAACTCGAGTTGTTGACCAGTACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-674s1c1
Sequence:CCGGGCTGACAGGATTCTGGTGAATCTCGAGATTCACCAGAATCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-303s1c1
Sequence:CCGGCCTTCAAGAGTGATGATCCAACTCGAGTTGGATCATCACTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001236.2-653s1c1
Sequence:CCGGCGTCTGGATGAGAAGAGGAAACTCGAGTTTCCTCTTCTCATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-594s21c1
Sequence:CCGGCAACGAGTTACTGCCGATAATCTCGAGATTATCGGCAGTAACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-881s21c1
Sequence:CCGGCTGACAGGATTCTGGTGAATGCTCGAGCATTCACCAGAATCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-525s21c1
Sequence:CCGGTCCAATGCCCTTTGACATTAACTCGAGTTAATGTCAAAGGGCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-622s21c1
Sequence:CCGGCATGGGAGAGTGGTGAATATCCTCGAGGATATTCACCACTCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-552s21c1
Sequence:CCGGGATGACACTGAAGACAAATTTCTCGAGAAATTTGTCTTCAGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001236
VALIDATED
CBR3 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-387s1c1
Sequence:CCGGGCAACGAGTTACTGCCGATAACTCGAGTTATCGGCAGTAACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-271s1c1
Sequence:CCGGGCTCAACGTACTGGTCAACAACTCGAGTTGTTGACCAGTACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-674s1c1
Sequence:CCGGGCTGACAGGATTCTGGTGAATCTCGAGATTCACCAGAATCCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001236.2-303s1c1
Sequence:CCGGCCTTCAAGAGTGATGATCCAACTCGAGTTGGATCATCACTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001236.2-653s1c1
Sequence:CCGGCGTCTGGATGAGAAGAGGAAACTCGAGTTTCCTCTTCTCATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-594s21c1
Sequence:CCGGCAACGAGTTACTGCCGATAATCTCGAGATTATCGGCAGTAACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-881s21c1
Sequence:CCGGCTGACAGGATTCTGGTGAATGCTCGAGCATTCACCAGAATCCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-525s21c1
Sequence:CCGGTCCAATGCCCTTTGACATTAACTCGAGTTAATGTCAAAGGGCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-622s21c1
Sequence:CCGGCATGGGAGAGTGGTGAATATCCTCGAGGATATTCACCACTCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001236.3-552s21c1
Sequence:CCGGGATGACACTGAAGACAAATTTCTCGAGAAATTTGTCTTCAGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173047
VALIDATED
CBR3 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-153s1c1
Sequence:CCGGGCTAACAAAGGCATCGGCTTTCTCGAGAAAGCCGATGCCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-397s1c1
Sequence:CCGGCCTTTAGAATGGATGACCCAACTCGAGTTGGGTCATCCATTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-414s1c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-922s1c1
Sequence:CCGGTCCGTGACAAAGTTGTGCAAACTCGAGTTTGCACAACTTTGTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-481s1c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-356s21c1
Sequence:CCGGCTTAACGTGCTGGTCAACAACCTCGAGGTTGTTGACCAGCACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-471s21c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-605s21c1
Sequence:CCGGGACCTGGTCGACCTCATGAAACTCGAGTTTCATGAGGTCGACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-759s21c1
Sequence:CCGGCGGACAGGATTCTGCTCAATGCTCGAGCATTGAGCAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-404s21c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-994s21c1
Sequence:CCGGCTGGTGTGGTCTGATTCTTTCCTCGAGGAAAGAATCAGACCACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-969s21c1
Sequence:CCGGCGTTAGCGGGAGAGATGAATGCTCGAGCATTCATCTCTCCCGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173047
VALIDATED
CBR3 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-153s1c1
Sequence:CCGGGCTAACAAAGGCATCGGCTTTCTCGAGAAAGCCGATGCCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-397s1c1
Sequence:CCGGCCTTTAGAATGGATGACCCAACTCGAGTTGGGTCATCCATTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-414s1c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-922s1c1
Sequence:CCGGTCCGTGACAAAGTTGTGCAAACTCGAGTTTGCACAACTTTGTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-481s1c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-356s21c1
Sequence:CCGGCTTAACGTGCTGGTCAACAACCTCGAGGTTGTTGACCAGCACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-471s21c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-605s21c1
Sequence:CCGGGACCTGGTCGACCTCATGAAACTCGAGTTTCATGAGGTCGACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-759s21c1
Sequence:CCGGCGGACAGGATTCTGCTCAATGCTCGAGCATTGAGCAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-404s21c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-994s21c1
Sequence:CCGGCTGGTGTGGTCTGATTCTTTCCTCGAGGAAAGAATCAGACCACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-969s21c1
Sequence:CCGGCGTTAGCGGGAGAGATGAATGCTCGAGCATTCATCTCTCCCGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173047
VALIDATED
CBR3 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-153s1c1
Sequence:CCGGGCTAACAAAGGCATCGGCTTTCTCGAGAAAGCCGATGCCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-397s1c1
Sequence:CCGGCCTTTAGAATGGATGACCCAACTCGAGTTGGGTCATCCATTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-414s1c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173047.2-922s1c1
Sequence:CCGGTCCGTGACAAAGTTGTGCAAACTCGAGTTTGCACAACTTTGTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173047.2-481s1c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-356s21c1
Sequence:CCGGCTTAACGTGCTGGTCAACAACCTCGAGGTTGTTGACCAGCACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-471s21c1
Sequence:CCGGGCACTGAGTTACTGCCTATAACTCGAGTTATAGGCAGTAACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-605s21c1
Sequence:CCGGGACCTGGTCGACCTCATGAAACTCGAGTTTCATGAGGTCGACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-759s21c1
Sequence:CCGGCGGACAGGATTCTGCTCAATGCTCGAGCATTGAGCAGAATCCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173047.3-404s21c1
Sequence:CCGGCCAACACCCTTCGACATTCAACTCGAGTTGAATGTCGAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-994s21c1
Sequence:CCGGCTGGTGTGGTCTGATTCTTTCCTCGAGGAAAGAATCAGACCACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173047.3-969s21c1
Sequence:CCGGCGTTAGCGGGAGAGATGAATGCTCGAGCATTCATCTCTCCCGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks