EMAIL THIS PAGE TO A FRIEND

CBR4

carbonyl reductase 4

60 Gene Product Result for
Synonyms: SDR45C1
UniProtKB ID: Q8N4T8, Q8WTW8, Q96K93
Gene ID:
Mouse(234309) carbonyl reductase 4
Rat(359725) carbonyl reductase 4
Zebrafish(402954) carbonyl reductase 4
cow(533020) carbonyl reductase 4
domestic cat(101094263) carbonyl reductase 4
dog(477352) carbonyl reductase 4
chicken(422435) carbonyl reductase 4
sheep(101122167) carbonyl reductase 4
domestic guinea pig(100729071) carbonyl reductase 4
naked mole-rat(101701861) carbonyl reductase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032783 Rosetta Predictions human pricing
NM_182672 Rosetta Predictions rat pricing
NM_145595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166434 predicted 474
2 SASI_Hs01_00166435 predicted 323
3 SASI_Hs02_00360336 predicted 321
4 SASI_Hs01_00166436 predicted 617
5 SASI_Hs01_00166437 predicted 694
6 SASI_Hs01_00166439 predicted 305
7 SASI_Hs01_00166440 predicted 580
8 SASI_Hs01_00166441 predicted 596
9 SASI_Hs02_00360337 predicted 734
10 SASI_Hs01_00166443 predicted 846
11 SASI_Hs01_00166438 predicted 809
12 SASI_Hs01_00166442 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109064 predicted 810
2 SASI_Rn01_00109065 predicted 495
3 SASI_Rn01_00109067 predicted 804
4 SASI_Rn01_00109068 predicted 633
5 SASI_Rn01_00109069 predicted 859
6 SASI_Rn01_00109070 predicted 618
7 SASI_Rn01_00109071 predicted 465
8 SASI_Rn01_00109072 predicted 805
9 SASI_Rn01_00109073 predicted 629
10 SASI_Rn02_00269822 predicted 338
11 SASI_Rn01_00109066 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341132 predicted 593
2 SASI_Mm01_00125948 predicted 594
3 SASI_Mm01_00125950 predicted 430
4 SASI_Mm01_00125951 predicted 452
5 SASI_Mm01_00125952 predicted 658
6 SASI_Mm01_00125953 predicted 649
7 SASI_Mm02_00341133 predicted 814
8 SASI_Mm01_00125954 predicted 453
9 SASI_Mm01_00125955 predicted 397
10 SASI_Mm01_00125956 predicted 765
11 SASI_Mm01_00125949 predicted 821
12 SASI_Mm01_00125957 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145595
VALIDATED
CBR4 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-720s21c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-432s21c1
Sequence:CCGGATTCAGCAGGGAGGGTCTATTCTCGAGAATAGACCCTCCCTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145595.1-246s21c1
Sequence:CCGGCAAGATGTTCAGAGTACATTTCTCGAGAAATGTACTCTGAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-842s21c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-757s21c1
Sequence:CCGGGATTGCAGCTCACCGTCTAATCTCGAGATTAGACGGTGAGCTGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-276s1c1
Sequence:CCGGGAGAAACATTTAGGTCCAGTACTCGAGTACTGGACCTAAATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-331s1c1
Sequence:CCGGGCAGTCTTCTAGTAAGAACAACTCGAGTTGTTCTTACTAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-720s1c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-594s1c1
Sequence:CCGGCCAGGATTTATTCGCACGGATCTCGAGATCCGTGCGAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-842s1c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145595
VALIDATED
CBR4 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-720s21c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-432s21c1
Sequence:CCGGATTCAGCAGGGAGGGTCTATTCTCGAGAATAGACCCTCCCTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145595.1-246s21c1
Sequence:CCGGCAAGATGTTCAGAGTACATTTCTCGAGAAATGTACTCTGAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-842s21c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-757s21c1
Sequence:CCGGGATTGCAGCTCACCGTCTAATCTCGAGATTAGACGGTGAGCTGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-276s1c1
Sequence:CCGGGAGAAACATTTAGGTCCAGTACTCGAGTACTGGACCTAAATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-331s1c1
Sequence:CCGGGCAGTCTTCTAGTAAGAACAACTCGAGTTGTTCTTACTAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-720s1c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-594s1c1
Sequence:CCGGCCAGGATTTATTCGCACGGATCTCGAGATCCGTGCGAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-842s1c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145595
VALIDATED
CBR4 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-720s21c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-432s21c1
Sequence:CCGGATTCAGCAGGGAGGGTCTATTCTCGAGAATAGACCCTCCCTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145595.1-246s21c1
Sequence:CCGGCAAGATGTTCAGAGTACATTTCTCGAGAAATGTACTCTGAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-842s21c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145595.1-757s21c1
Sequence:CCGGGATTGCAGCTCACCGTCTAATCTCGAGATTAGACGGTGAGCTGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-276s1c1
Sequence:CCGGGAGAAACATTTAGGTCCAGTACTCGAGTACTGGACCTAAATGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-331s1c1
Sequence:CCGGGCAGTCTTCTAGTAAGAACAACTCGAGTTGTTCTTACTAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-720s1c1
Sequence:CCGGCCATACATCACAGGCCATGTTCTCGAGAACATGGCCTGTGATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145595.1-594s1c1
Sequence:CCGGCCAGGATTTATTCGCACGGATCTCGAGATCCGTGCGAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145595.1-842s1c1
Sequence:CCGGCTCATCTATATGGGTGACATTCTCGAGAATGTCACCCATATAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032783
VALIDATED
CBR4 MISSION shRNA Bacterial Glycerol Stock
carbonyl reductase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032783.3-1486s21c1
Sequence:CCGGCCCACTAAAGATAACTATATTCTCGAGAATATAGTTATCTTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-605s21c1
Sequence:CCGGCAACTCTGGCCAGTCCGTTTACTCGAGTAAACGGACTGGCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-422s21c1
Sequence:CCGGGGTAAATGCAGCTGGTATTAACTCGAGTTAATACCAGCTGCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-314s21c1
Sequence:CCGGTGACCTCGGCGGAGATCATTTCTCGAGAAATGATCTCCGCCGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-227s21c1
Sequence:CCGGCAGAGCTGTGGCCCAGTTAATCTCGAGATTAACTGGGCCACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-298s1c1
Sequence:CCGGGCGGAGATCATTTGGCATTTACTCGAGTAAATGCCAAATGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-606s1c1
Sequence:CCGGGCCAGTAAAGGAGGATTAGTTCTCGAGAACTAATCCTCCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-816s1c1
Sequence:CCGGCCGTATATTACAGGGCATGTTCTCGAGAACATGCCCTGTAATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032783.2-690s1c1
Sequence:CCGGCCAGGATTTGTACACACAGATCTCGAGATCTGTGTGTACAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-507s1c1
Sequence:CCGGGCTGCCATGAGGACTATGATTCTCGAGAATCATAGTCCTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032783
VALIDATED
CBR4 MISSION shRNA shRNA Plasmid DNA
carbonyl reductase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032783.3-1486s21c1
Sequence:CCGGCCCACTAAAGATAACTATATTCTCGAGAATATAGTTATCTTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-605s21c1
Sequence:CCGGCAACTCTGGCCAGTCCGTTTACTCGAGTAAACGGACTGGCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-422s21c1
Sequence:CCGGGGTAAATGCAGCTGGTATTAACTCGAGTTAATACCAGCTGCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-314s21c1
Sequence:CCGGTGACCTCGGCGGAGATCATTTCTCGAGAAATGATCTCCGCCGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-227s21c1
Sequence:CCGGCAGAGCTGTGGCCCAGTTAATCTCGAGATTAACTGGGCCACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-298s1c1
Sequence:CCGGGCGGAGATCATTTGGCATTTACTCGAGTAAATGCCAAATGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-606s1c1
Sequence:CCGGGCCAGTAAAGGAGGATTAGTTCTCGAGAACTAATCCTCCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-816s1c1
Sequence:CCGGCCGTATATTACAGGGCATGTTCTCGAGAACATGCCCTGTAATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032783.2-690s1c1
Sequence:CCGGCCAGGATTTGTACACACAGATCTCGAGATCTGTGTGTACAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-507s1c1
Sequence:CCGGGCTGCCATGAGGACTATGATTCTCGAGAATCATAGTCCTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032783
VALIDATED
CBR4 MISSION shRNA Lentiviral Transduction Particles
carbonyl reductase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032783.3-1486s21c1
Sequence:CCGGCCCACTAAAGATAACTATATTCTCGAGAATATAGTTATCTTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-605s21c1
Sequence:CCGGCAACTCTGGCCAGTCCGTTTACTCGAGTAAACGGACTGGCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-422s21c1
Sequence:CCGGGGTAAATGCAGCTGGTATTAACTCGAGTTAATACCAGCTGCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-314s21c1
Sequence:CCGGTGACCTCGGCGGAGATCATTTCTCGAGAAATGATCTCCGCCGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032783.3-227s21c1
Sequence:CCGGCAGAGCTGTGGCCCAGTTAATCTCGAGATTAACTGGGCCACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-298s1c1
Sequence:CCGGGCGGAGATCATTTGGCATTTACTCGAGTAAATGCCAAATGATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-606s1c1
Sequence:CCGGGCCAGTAAAGGAGGATTAGTTCTCGAGAACTAATCCTCCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-816s1c1
Sequence:CCGGCCGTATATTACAGGGCATGTTCTCGAGAACATGCCCTGTAATATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032783.2-690s1c1
Sequence:CCGGCCAGGATTTGTACACACAGATCTCGAGATCTGTGTGTACAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032783.2-507s1c1
Sequence:CCGGGCTGCCATGAGGACTATGATTCTCGAGAATCATAGTCCTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks