EMAIL THIS PAGE TO A FRIEND

CBWD1

COBW domain containing 1

67 Gene Product Result for
Synonyms: COBP
Gene ID:
Mouse(226043) COBW domain containing 1
Rat(171057) COBW domain containing 1
chicken(427347) COBW domain containing 1
dog(484176) COBW domain containing 1
Horse(100050598) COBW domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073531 MISSION® esiRNA esiRNA targeting mouse Cbwd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018491 Rosetta Predictions human pricing
NM_133535 Rosetta Predictions rat pricing
NM_146097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110367 predicted 1032
2 SASI_Hs01_00110369 predicted 1026
3 SASI_Hs01_00110371 predicted 1039
4 SASI_Hs02_00352082 predicted 967
5 SASI_Hs02_00352083 predicted 1016
6 SASI_Hs02_00352084 predicted 1032
7 SASI_Hs02_00352085 predicted 1039
8 SASI_Hs02_00352086 predicted 962
9 SASI_Hs02_00352087 predicted 959
10 SASI_Hs01_00110372 predicted 965
11 SASI_Hs01_00110366 predicted 209
12 SASI_Hs01_00110368 predicted 305
13 SASI_Hs01_00110370 predicted 235
14 SASI_Hs01_00110373 predicted 230
15 SASI_Hs01_00110374 predicted 231
16 SASI_Hs01_00110375 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104778 predicted 973
2 SASI_Rn01_00104779 predicted 563
3 SASI_Rn01_00104781 predicted 389
4 SASI_Rn01_00104782 predicted 341
5 SASI_Rn02_00267718 predicted 754
6 SASI_Rn02_00267719 predicted 390
7 SASI_Rn01_00104786 predicted 655
8 SASI_Rn01_00104787 predicted 705
9 SASI_Rn02_00267720 predicted 501
10 SASI_Rn02_00267721 predicted 497
11 SASI_Rn01_00104780 predicted 1343
12 SASI_Rn01_00104783 predicted 1245
13 SASI_Rn01_00104784 predicted 1309
14 SASI_Rn01_00104785 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064209 predicted 210
2 SASI_Mm01_00064210 predicted 882
3 SASI_Mm01_00064212 predicted 574
4 SASI_Mm01_00064213 predicted 884
5 SASI_Mm02_00341737 predicted 722
6 SASI_Mm01_00064214 predicted 823
7 SASI_Mm02_00341738 predicted 1086
8 SASI_Mm01_00064215 predicted 995
9 SASI_Mm01_00064216 predicted 820
10 SASI_Mm01_00064217 predicted 510
11 SASI_Mm01_00064211 predicted 987
12 SASI_Mm01_00064218 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018491
VALIDATED
CBWD1 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-272s21c1
Sequence:CCGGACAACACTTCTGAACTATATTCTCGAGAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018491.3-1336s21c1
Sequence:CCGGTAAGTTTCTACTGGGTATATTCTCGAGAATATACCCAGTAGAAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-590s21c1
Sequence:CCGGCTTGATGGTATCATAACTATTCTCGAGAATAGTTATGATACCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-239s21c1
Sequence:CCGGACAATTATCACCGGGTATTTACTCGAGTAAATACCCGGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-567s21c1
Sequence:CCGGCTGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018491.2-1493s1c1
Sequence:CCGGGCTTTGGAGTTTACATATACTCTCGAGAGTATATGTAAACTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-917s1c1
Sequence:CCGGGCAAAGGAAGAACATCTTAATCTCGAGATTAAGATGTTCTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-1188s1c1
Sequence:CCGGCTACTGTGACAGAAACAGAAACTCGAGTTTCTGTTTCTGTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018491
VALIDATED
CBWD1 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-272s21c1
Sequence:CCGGACAACACTTCTGAACTATATTCTCGAGAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018491.3-1336s21c1
Sequence:CCGGTAAGTTTCTACTGGGTATATTCTCGAGAATATACCCAGTAGAAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-590s21c1
Sequence:CCGGCTTGATGGTATCATAACTATTCTCGAGAATAGTTATGATACCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-239s21c1
Sequence:CCGGACAATTATCACCGGGTATTTACTCGAGTAAATACCCGGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-567s21c1
Sequence:CCGGCTGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018491.2-1493s1c1
Sequence:CCGGGCTTTGGAGTTTACATATACTCTCGAGAGTATATGTAAACTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-917s1c1
Sequence:CCGGGCAAAGGAAGAACATCTTAATCTCGAGATTAAGATGTTCTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-1188s1c1
Sequence:CCGGCTACTGTGACAGAAACAGAAACTCGAGTTTCTGTTTCTGTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018491
VALIDATED
CBWD1 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-272s21c1
Sequence:CCGGACAACACTTCTGAACTATATTCTCGAGAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018491.3-1336s21c1
Sequence:CCGGTAAGTTTCTACTGGGTATATTCTCGAGAATATACCCAGTAGAAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018491.3-590s21c1
Sequence:CCGGCTTGATGGTATCATAACTATTCTCGAGAATAGTTATGATACCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-239s21c1
Sequence:CCGGACAATTATCACCGGGTATTTACTCGAGTAAATACCCGGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018491.3-567s21c1
Sequence:CCGGCTGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018491.2-1493s1c1
Sequence:CCGGGCTTTGGAGTTTACATATACTCTCGAGAGTATATGTAAACTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-917s1c1
Sequence:CCGGGCAAAGGAAGAACATCTTAATCTCGAGATTAAGATGTTCTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018491.2-1188s1c1
Sequence:CCGGCTACTGTGACAGAAACAGAAACTCGAGTTTCTGTTTCTGTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146097
VALIDATED
CBWD1 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.2-671s1c1
Sequence:CCGGGAACAACTATCAGATCAATAACTCGAGTTATTGATCTGATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-869s1c1
Sequence:CCGGGTGCAAAGGAAGAGTGTCTAACTCGAGTTAGACACTCTTCCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-611s1c1
Sequence:CCGGCAGACATGATTCTCATCAATACTCGAGTATTGATGAGAATCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-834s1c1
Sequence:CCGGGAGTATTGTTACAGTCACATTCTCGAGAATGTGACTGTAACAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146097.1-376s1c1
Sequence:CCGGGCTATAGAGAATCTGATGCAACTCGAGTTGCATCAGATTCTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-1048s1c1
Sequence:CCGGCTAGTGAACTGGAAGGATGATCTCGAGATCATCCTTCCAGTTCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-94s1c1
Sequence:CCGGCCCATTGAGACCAAGAACCAACTCGAGTTGGTTCTTGGTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-1086s1c1
Sequence:CCGGGCTGGTCTTCATTGGTAGAAACTCGAGTTTCTACCAATGAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-762s1c1
Sequence:CCGGCTATGATATTCTCTCTGGAATCTCGAGATTCCAGAGAGAATATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-610s1c1
Sequence:CCGGGCAGACATGATTCTCATCAATCTCGAGATTGATGAGAATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146097
VALIDATED
CBWD1 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.2-671s1c1
Sequence:CCGGGAACAACTATCAGATCAATAACTCGAGTTATTGATCTGATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-869s1c1
Sequence:CCGGGTGCAAAGGAAGAGTGTCTAACTCGAGTTAGACACTCTTCCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-611s1c1
Sequence:CCGGCAGACATGATTCTCATCAATACTCGAGTATTGATGAGAATCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-834s1c1
Sequence:CCGGGAGTATTGTTACAGTCACATTCTCGAGAATGTGACTGTAACAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146097.1-376s1c1
Sequence:CCGGGCTATAGAGAATCTGATGCAACTCGAGTTGCATCAGATTCTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-1048s1c1
Sequence:CCGGCTAGTGAACTGGAAGGATGATCTCGAGATCATCCTTCCAGTTCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-94s1c1
Sequence:CCGGCCCATTGAGACCAAGAACCAACTCGAGTTGGTTCTTGGTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-1086s1c1
Sequence:CCGGGCTGGTCTTCATTGGTAGAAACTCGAGTTTCTACCAATGAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-762s1c1
Sequence:CCGGCTATGATATTCTCTCTGGAATCTCGAGATTCCAGAGAGAATATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-610s1c1
Sequence:CCGGGCAGACATGATTCTCATCAATCTCGAGATTGATGAGAATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146097
VALIDATED
CBWD1 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.2-671s1c1
Sequence:CCGGGAACAACTATCAGATCAATAACTCGAGTTATTGATCTGATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-869s1c1
Sequence:CCGGGTGCAAAGGAAGAGTGTCTAACTCGAGTTAGACACTCTTCCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-611s1c1
Sequence:CCGGCAGACATGATTCTCATCAATACTCGAGTATTGATGAGAATCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-834s1c1
Sequence:CCGGGAGTATTGTTACAGTCACATTCTCGAGAATGTGACTGTAACAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146097.1-376s1c1
Sequence:CCGGGCTATAGAGAATCTGATGCAACTCGAGTTGCATCAGATTCTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146097.1-1048s1c1
Sequence:CCGGCTAGTGAACTGGAAGGATGATCTCGAGATCATCCTTCCAGTTCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-94s1c1
Sequence:CCGGCCCATTGAGACCAAGAACCAACTCGAGTTGGTTCTTGGTCTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-1086s1c1
Sequence:CCGGGCTGGTCTTCATTGGTAGAAACTCGAGTTTCTACCAATGAAGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-762s1c1
Sequence:CCGGCTATGATATTCTCTCTGGAATCTCGAGATTCCAGAGAGAATATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146097.1-610s1c1
Sequence:CCGGGCAGACATGATTCTCATCAATCTCGAGATTGATGAGAATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks