EMAIL THIS PAGE TO A FRIEND

CBWD3

COBW domain containing 3

34 Gene Product Result for
Synonyms: bA561O23.1
Species: Human CBWD3(445571)
UniProtKB ID: Q5JTY5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201453 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372986 predicted 222
2 SASI_Hs02_00372987 predicted 270
3 SASI_Hs02_00372988 predicted 219
4 SASI_Hs01_00219584 predicted 270
5 SASI_Hs02_00372989 predicted 223
6 SASI_Hs02_00372990 predicted 232
7 SASI_Hs02_00372991 predicted 268
8 SASI_Hs02_00372992 predicted 225
9 SASI_Hs02_00372993 predicted 224
10 SASI_Hs02_00372994 predicted 220
11 SASI_Hs01_00219582 predicted 460
12 SASI_Hs01_00219583 predicted 636
13 SASI_Hs01_00219585 predicted 405
14 SASI_Hs01_00219586 predicted 1226
15 SASI_Hs01_00219587 predicted 526
16 SASI_Hs01_00219588 predicted 1003
17 SASI_Hs01_00219589 predicted 727
18 SASI_Hs01_00219590 predicted 1021
19 SASI_Hs01_00219591 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201453
CBWD3 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1108s1c1
Sequence:CCGGGATGACACTGAGAGAACAAATCTCGAGATTTGTTCTCTCAGTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-617s1c1
Sequence:CCGGGCCTTATCAATGAAGCTACTACTCGAGTAGTAGCTTCATTGATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-904s1c1
Sequence:CCGGGTACCAGGAAATGCAAAGGAACTCGAGTTCCTTTGCATTTCCTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-193s1c1
Sequence:CCGGGTCACAATTATCACCGGGTATCTCGAGATACCCGGTGATAATTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-1209s1c1
Sequence:CCGGGCAGTGGACAACACATTTCAACTCGAGTTGAAATGTGTTGTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-520s1c1
Sequence:CCGGGATGCTGAATTAGGGAGTGATCTCGAGATCACTCCCTAATTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1011s1c1
Sequence:CCGGGAAGGGATTGGTGTCAATCAACTCGAGTTGATTGACACCAATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201453
CBWD3 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1108s1c1
Sequence:CCGGGATGACACTGAGAGAACAAATCTCGAGATTTGTTCTCTCAGTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-617s1c1
Sequence:CCGGGCCTTATCAATGAAGCTACTACTCGAGTAGTAGCTTCATTGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-904s1c1
Sequence:CCGGGTACCAGGAAATGCAAAGGAACTCGAGTTCCTTTGCATTTCCTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-193s1c1
Sequence:CCGGGTCACAATTATCACCGGGTATCTCGAGATACCCGGTGATAATTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-1209s1c1
Sequence:CCGGGCAGTGGACAACACATTTCAACTCGAGTTGAAATGTGTTGTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-520s1c1
Sequence:CCGGGATGCTGAATTAGGGAGTGATCTCGAGATCACTCCCTAATTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1011s1c1
Sequence:CCGGGAAGGGATTGGTGTCAATCAACTCGAGTTGATTGACACCAATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201453
CBWD3 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1108s1c1
Sequence:CCGGGATGACACTGAGAGAACAAATCTCGAGATTTGTTCTCTCAGTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-617s1c1
Sequence:CCGGGCCTTATCAATGAAGCTACTACTCGAGTAGTAGCTTCATTGATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-904s1c1
Sequence:CCGGGTACCAGGAAATGCAAAGGAACTCGAGTTCCTTTGCATTTCCTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-193s1c1
Sequence:CCGGGTCACAATTATCACCGGGTATCTCGAGATACCCGGTGATAATTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-1209s1c1
Sequence:CCGGGCAGTGGACAACACATTTCAACTCGAGTTGAAATGTGTTGTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201453.1-520s1c1
Sequence:CCGGGATGCTGAATTAGGGAGTGATCTCGAGATCACTCCCTAATTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201453.1-1011s1c1
Sequence:CCGGGAAGGGATTGGTGTCAATCAACTCGAGTTGATTGACACCAATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)