EMAIL THIS PAGE TO A FRIEND

CBWD6

COBW domain containing 6

Species: Human CBWD6(644019)
UniProtKB ID: Q4V339
Gene ID:
337 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305946 ANTI-CBWD6 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085457 Rosetta Predictions human pricing
XM_928822 Rosetta Predictions human pricing
XM_933089 Rosetta Predictions human pricing
XM_933093 Rosetta Predictions human pricing
XM_933098 Rosetta Predictions human pricing
XM_933103 Rosetta Predictions human pricing
XM_933106 Rosetta Predictions human pricing
XM_933114 Rosetta Predictions human pricing
XM_933120 Rosetta Predictions human pricing
XM_933127 Rosetta Predictions human pricing
XM_933131 Rosetta Predictions human pricing
XM_933135 Rosetta Predictions human pricing
XM_933139 Rosetta Predictions human pricing
XM_933143 Rosetta Predictions human pricing
XM_933148 Rosetta Predictions human pricing
XM_933152 Rosetta Predictions human pricing
XM_933156 Rosetta Predictions human pricing
XM_933160 Rosetta Predictions human pricing
XM_933163 Rosetta Predictions human pricing
XM_933170 Rosetta Predictions human pricing
XM_933175 Rosetta Predictions human pricing
XM_933180 Rosetta Predictions human pricing
XM_933184 Rosetta Predictions human pricing
XM_933190 Rosetta Predictions human pricing
XM_933196 Rosetta Predictions human pricing
XM_933200 Rosetta Predictions human pricing
XM_933204 Rosetta Predictions human pricing
XM_933210 Rosetta Predictions human pricing
XM_933215 Rosetta Predictions human pricing
XM_933219 Rosetta Predictions human pricing
XM_933222 Rosetta Predictions human pricing
XM_933226 Rosetta Predictions human pricing
XM_933232 Rosetta Predictions human pricing
XM_933236 Rosetta Predictions human pricing
XM_933238 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317785 predicted 216
2 SASI_Hs02_00317786 predicted 264
3 SASI_Hs02_00317787 predicted 216
4 SASI_Hs02_00317788 predicted 264
5 SASI_Hs02_00317789 predicted 220
6 SASI_Hs02_00317790 predicted 230
7 SASI_Hs02_00317791 predicted 266
8 SASI_Hs02_00317792 predicted 222
9 SASI_Hs02_00317793 predicted 220
10 SASI_Hs02_00317794 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292489 predicted 944
2 SASI_Hs01_00292490 predicted 1005
3 SASI_Hs01_00292491 predicted 714
4 SASI_Hs01_00292492 predicted 663
5 SASI_Hs01_00292493 predicted 889
6 SASI_Hs01_00292494 predicted 1704
7 SASI_Hs01_00292495 predicted 1479
8 SASI_Hs01_00292496 predicted 1211
9 SASI_Hs01_00292497 predicted 670
10 SASI_Hs01_00292498 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249662 predicted 537
2 SASI_Hs01_00249663 predicted 537
3 SASI_Hs01_00249664 predicted 777
4 SASI_Hs01_00249665 predicted 543
5 SASI_Hs01_00249666 predicted 692
6 SASI_Hs01_00249667 predicted 571
7 SASI_Hs01_00249668 predicted 591
8 SASI_Hs01_00249669 predicted 755
9 SASI_Hs01_00249670 predicted 561
10 SASI_Hs01_00249671 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292104 predicted 932
2 SASI_Hs01_00292105 predicted 924
3 SASI_Hs01_00292106 predicted 1163
4 SASI_Hs01_00292107 predicted 944
5 SASI_Hs01_00292108 predicted 1121
6 SASI_Hs01_00292109 predicted 961
7 SASI_Hs01_00292110 predicted 980
8 SASI_Hs01_00292111 predicted 1152
9 SASI_Hs01_00292112 predicted 998
10 SASI_Hs01_00292113 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278315 predicted 948
2 SASI_Hs01_00278316 predicted 1004
3 SASI_Hs01_00278317 predicted 1115
4 SASI_Hs01_00278318 predicted 1003
5 SASI_Hs01_00278319 predicted 714
6 SASI_Hs01_00278320 predicted 668
7 SASI_Hs01_00278321 predicted 883
8 SASI_Hs01_00278322 predicted 1391
9 SASI_Hs01_00278323 predicted 880
10 SASI_Hs01_00278324 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283823 predicted 950
2 SASI_Hs01_00283824 predicted 987
3 SASI_Hs01_00283825 predicted 709
4 SASI_Hs01_00283826 predicted 663
5 SASI_Hs01_00283827 predicted 890
6 SASI_Hs01_00283828 predicted 1005
7 SASI_Hs01_00283829 predicted 674
8 SASI_Hs01_00283830 predicted 708
9 SASI_Hs01_00283831 predicted 596
10 SASI_Hs01_00283832 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259131 predicted 948
2 SASI_Hs01_00259132 predicted 716
3 SASI_Hs01_00259133 predicted 659
4 SASI_Hs01_00259134 predicted 886
5 SASI_Hs01_00259135 predicted 885
6 SASI_Hs01_00259136 predicted 674
7 SASI_Hs01_00259137 predicted 1102
8 SASI_Hs01_00259138 predicted 889
9 SASI_Hs01_00259139 predicted 853
10 SASI_Hs01_00259140 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277053 predicted 1009
2 SASI_Hs01_00277054 predicted 1032
3 SASI_Hs01_00277055 predicted 727
4 SASI_Hs01_00277056 predicted 1000
5 SASI_Hs01_00277057 predicted 721
6 SASI_Hs01_00277058 predicted 1007
7 SASI_Hs01_00277059 predicted 1074
8 SASI_Hs01_00277060 predicted 1016
9 SASI_Hs01_00277061 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272835 predicted 595
2 SASI_Hs01_00272836 predicted 708
3 SASI_Hs01_00272837 predicted 669
4 SASI_Hs01_00272838 predicted 791
5 SASI_Hs01_00272839 predicted 670
6 SASI_Hs01_00272840 predicted 710
7 SASI_Hs01_00272841 predicted 598
8 SASI_Hs01_00272842 predicted 664
9 SASI_Hs01_00272843 predicted 625
10 SASI_Hs01_00272844 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263490 predicted 943
2 SASI_Hs01_00263491 predicted 715
3 SASI_Hs01_00263492 predicted 665
4 SASI_Hs01_00263493 predicted 882
5 SASI_Hs01_00263494 predicted 883
6 SASI_Hs01_00263495 predicted 670
7 SASI_Hs01_00263496 predicted 705
8 SASI_Hs01_00263497 predicted 602
9 SASI_Hs01_00263498 predicted 903
10 SASI_Hs01_00263499 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269785 predicted 944
2 SASI_Hs01_00269786 predicted 713
3 SASI_Hs01_00269787 predicted 666
4 SASI_Hs01_00269788 predicted 889
5 SASI_Hs01_00269789 predicted 882
6 SASI_Hs01_00269790 predicted 673
7 SASI_Hs01_00269791 predicted 893
8 SASI_Hs01_00269792 predicted 855
9 SASI_Hs01_00269793 predicted 900
10 SASI_Hs01_00269794 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293143 predicted 915
2 SASI_Hs01_00293144 predicted 935
3 SASI_Hs01_00293145 predicted 897
4 SASI_Hs01_00293146 predicted 716
5 SASI_Hs01_00293147 predicted 668
6 SASI_Hs01_00293148 predicted 672
7 SASI_Hs01_00293149 predicted 707
8 SASI_Hs01_00293150 predicted 602
9 SASI_Hs01_00293151 predicted 661
10 SASI_Hs01_00293152 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265029 predicted 1005
2 SASI_Hs01_00265030 predicted 1030
3 SASI_Hs01_00265031 predicted 997
4 SASI_Hs01_00265032 predicted 1007
5 SASI_Hs01_00265033 predicted 1066
6 SASI_Hs01_00265034 predicted 1005
7 SASI_Hs01_00265035 predicted 1011
8 SASI_Hs01_00265036 predicted 1048
9 SASI_Hs01_00265037 predicted 991
10 SASI_Hs01_00265038 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292683 predicted 942
2 SASI_Hs01_00292684 predicted 713
3 SASI_Hs01_00292685 predicted 668
4 SASI_Hs01_00292686 predicted 889
5 SASI_Hs01_00292687 predicted 889
6 SASI_Hs01_00292688 predicted 672
7 SASI_Hs01_00292689 predicted 895
8 SASI_Hs01_00292690 predicted 851
9 SASI_Hs01_00292691 predicted 904
10 SASI_Hs01_00292692 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248318 predicted 942
2 SASI_Hs01_00248319 predicted 1273
3 SASI_Hs01_00248320 predicted 1127
4 SASI_Hs01_00248321 predicted 711
5 SASI_Hs01_00248322 predicted 665
6 SASI_Hs01_00248323 predicted 886
7 SASI_Hs01_00248324 predicted 889
8 SASI_Hs01_00248325 predicted 1222
9 SASI_Hs01_00248326 predicted 671
10 SASI_Hs01_00248327 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277309 predicted 946
2 SASI_Hs01_00277310 predicted 715
3 SASI_Hs01_00277311 predicted 661
4 SASI_Hs01_00277312 predicted 887
5 SASI_Hs01_00277313 predicted 1143
6 SASI_Hs01_00277314 predicted 886
7 SASI_Hs01_00277315 predicted 670
8 SASI_Hs01_00277316 predicted 1169
9 SASI_Hs01_00277317 predicted 1020
10 SASI_Hs01_00277318 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272796 predicted 1411
2 SASI_Hs01_00272797 predicted 1621
3 SASI_Hs01_00272798 predicted 1617
4 SASI_Hs01_00272799 predicted 1631
5 SASI_Hs01_00272800 predicted 1601
6 SASI_Hs01_00272801 predicted 1616
7 SASI_Hs01_00272802 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258489 predicted 946
2 SASI_Hs01_00258490 predicted 1086
3 SASI_Hs01_00258491 predicted 714
4 SASI_Hs01_00258492 predicted 668
5 SASI_Hs01_00258493 predicted 889
6 SASI_Hs01_00258494 predicted 883
7 SASI_Hs01_00258495 predicted 673
8 SASI_Hs01_00258496 predicted 897
9 SASI_Hs01_00258497 predicted 853
10 SASI_Hs01_00258498 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264644 predicted 298
2 SASI_Hs01_00264645 predicted 257
3 SASI_Hs01_00264646 predicted 386
4 SASI_Hs01_00264647 predicted 312
5 SASI_Hs01_00264648 predicted 198
6 SASI_Hs01_00264649 predicted 373
7 SASI_Hs01_00264650 predicted 328
8 SASI_Hs01_00264651 predicted 284
9 SASI_Hs01_00264652 predicted 271
10 SASI_Hs01_00264653 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283307 predicted 1715
2 SASI_Hs01_00283308 predicted 1586
3 SASI_Hs01_00283309 predicted 1723
4 SASI_Hs01_00283310 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256978 predicted 441
2 SASI_Hs01_00256979 predicted 319
3 SASI_Hs01_00256980 predicted 531
4 SASI_Hs01_00256981 predicted 480
5 SASI_Hs01_00256982 predicted 412
6 SASI_Hs01_00256983 predicted 327
7 SASI_Hs01_00256984 predicted 345
8 SASI_Hs01_00256985 predicted 518
9 SASI_Hs01_00256986 predicted 362
10 SASI_Hs01_00256987 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297735 predicted 1158
2 SASI_Hs01_00297736 predicted 1156
3 SASI_Hs01_00297737 predicted 1400
4 SASI_Hs01_00297738 predicted 1171
5 SASI_Hs01_00297739 predicted 1315
6 SASI_Hs01_00297740 predicted 1196
7 SASI_Hs01_00297741 predicted 1213
8 SASI_Hs01_00297742 predicted 1383
9 SASI_Hs01_00297743 predicted 1186
10 SASI_Hs01_00297744 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256749 predicted 243
2 SASI_Hs01_00256750 predicted 303
3 SASI_Hs01_00256751 predicted 661
4 SASI_Hs01_00256752 predicted 434
5 SASI_Hs01_00256753 predicted 582
6 SASI_Hs01_00256754 predicted 464
7 SASI_Hs01_00256755 predicted 302
8 SASI_Hs01_00256756 predicted 481
9 SASI_Hs01_00256757 predicted 468
10 SASI_Hs01_00256758 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250467 predicted 1699
2 SASI_Hs01_00250468 predicted 1561
3 SASI_Hs01_00250469 predicted 1699
4 SASI_Hs01_00250470 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292581 predicted 686
2 SASI_Hs01_00292582 predicted 684
3 SASI_Hs01_00292583 predicted 922
4 SASI_Hs01_00292584 predicted 698
5 SASI_Hs01_00292585 predicted 838
6 SASI_Hs01_00292586 predicted 719
7 SASI_Hs01_00292587 predicted 738
8 SASI_Hs01_00292588 predicted 908
9 SASI_Hs01_00292589 predicted 710
10 SASI_Hs01_00292590 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301464 predicted 440
2 SASI_Hs01_00301465 predicted 438
3 SASI_Hs01_00301466 predicted 669
4 SASI_Hs01_00301467 predicted 444
5 SASI_Hs01_00301468 predicted 595
6 SASI_Hs01_00301469 predicted 473
7 SASI_Hs01_00301470 predicted 486
8 SASI_Hs01_00301471 predicted 661
9 SASI_Hs01_00301472 predicted 460
10 SASI_Hs01_00301473 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257024 predicted 446
2 SASI_Hs01_00257025 predicted 509
3 SASI_Hs01_00257026 predicted 623
4 SASI_Hs01_00257027 predicted 220
5 SASI_Hs01_00257028 predicted 392
6 SASI_Hs01_00257029 predicted 1157
7 SASI_Hs01_00257030 predicted 933
8 SASI_Hs01_00257031 predicted 719
9 SASI_Hs01_00257032 predicted 953
10 SASI_Hs01_00257033 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249779 predicted 947
2 SASI_Hs01_00249780 predicted 713
3 SASI_Hs01_00249781 predicted 659
4 SASI_Hs01_00249782 predicted 884
5 SASI_Hs01_00249783 predicted 1462
6 SASI_Hs01_00249784 predicted 1238
7 SASI_Hs01_00249785 predicted 671
8 SASI_Hs01_00249786 predicted 1257
9 SASI_Hs01_00249787 predicted 1102
10 SASI_Hs01_00249788 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259411 predicted 949
2 SASI_Hs01_00259412 predicted 1004
3 SASI_Hs01_00259413 predicted 711
4 SASI_Hs01_00259414 predicted 659
5 SASI_Hs01_00259415 predicted 883
6 SASI_Hs01_00259416 predicted 1648
7 SASI_Hs01_00259417 predicted 1430
8 SASI_Hs01_00259418 predicted 1208
9 SASI_Hs01_00259419 predicted 679
10 SASI_Hs01_00259420 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299109 predicted 940
2 SASI_Hs01_00299110 predicted 1105
3 SASI_Hs01_00299111 predicted 717
4 SASI_Hs01_00299112 predicted 665
5 SASI_Hs01_00299113 predicted 884
6 SASI_Hs01_00299114 predicted 1569
7 SASI_Hs01_00299115 predicted 1336
8 SASI_Hs01_00299116 predicted 671
9 SASI_Hs01_00299117 predicted 1361
10 SASI_Hs01_00299118 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262754 predicted 574
2 SASI_Hs01_00262755 predicted 574
3 SASI_Hs01_00262756 predicted 819
4 SASI_Hs01_00262757 predicted 584
5 SASI_Hs01_00262758 predicted 735
6 SASI_Hs01_00262759 predicted 609
7 SASI_Hs01_00262760 predicted 628
8 SASI_Hs01_00262761 predicted 796
9 SASI_Hs01_00262762 predicted 603
10 SASI_Hs01_00262763 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285081 predicted 1099
2 SASI_Hs01_00285082 predicted 1224
3 SASI_Hs01_00285083 predicted 1103
4 SASI_Hs01_00285084 predicted 812
5 SASI_Hs01_00285085 predicted 1579
6 SASI_Hs01_00285086 predicted 1307
7 SASI_Hs01_00285087 predicted 1105
8 SASI_Hs01_00285088 predicted 1127
9 SASI_Hs01_00285089 predicted 1327
10 SASI_Hs01_00285090 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262349 predicted 941
2 SASI_Hs01_00262350 predicted 1052
3 SASI_Hs01_00262351 predicted 715
4 SASI_Hs01_00262352 predicted 663
5 SASI_Hs01_00262353 predicted 887
6 SASI_Hs01_00262354 predicted 1564
7 SASI_Hs01_00262355 predicted 1337
8 SASI_Hs01_00262356 predicted 673
9 SASI_Hs01_00262357 predicted 1363
10 SASI_Hs01_00262358 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288340 predicted 1102
2 SASI_Hs01_00288341 predicted 1223
3 SASI_Hs01_00288342 predicted 1103
4 SASI_Hs01_00288343 predicted 814
5 SASI_Hs01_00288344 predicted 1581
6 SASI_Hs01_00288345 predicted 1307
7 SASI_Hs01_00288346 predicted 1108
8 SASI_Hs01_00288347 predicted 1121
9 SASI_Hs01_00288348 predicted 1319
10 SASI_Hs01_00288349 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293645 predicted 946
2 SASI_Hs01_00293646 predicted 1007
3 SASI_Hs01_00293647 predicted 710
4 SASI_Hs01_00293648 predicted 667
5 SASI_Hs01_00293649 predicted 887
6 SASI_Hs01_00293650 predicted 1710
7 SASI_Hs01_00293651 predicted 1481
8 SASI_Hs01_00293652 predicted 1211
9 SASI_Hs01_00293653 predicted 674
10 SASI_Hs01_00293654 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085457
CBWD6 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-238s21c1
Sequence:CCGGCACAATTATCACCGGGTATTTCTCGAGAAATACCCGGTGATAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-567s21c1
Sequence:CCGGCCGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-591s21c1
Sequence:CCGGTTGATGGTATCATAACTATTGCTCGAGCAATAGTTATGATACCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-756s21c1
Sequence:CCGGGAACGACACTTAGATCCATAACTCGAGTTATGGATCTAAGTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085457.1-1335s21c1
Sequence:CCGGATAAGTTTCTACTGGGTATATCTCGAGATATACCCAGTAGAAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085457
CBWD6 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-238s21c1
Sequence:CCGGCACAATTATCACCGGGTATTTCTCGAGAAATACCCGGTGATAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-567s21c1
Sequence:CCGGCCGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-591s21c1
Sequence:CCGGTTGATGGTATCATAACTATTGCTCGAGCAATAGTTATGATACCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-756s21c1
Sequence:CCGGGAACGACACTTAGATCCATAACTCGAGTTATGGATCTAAGTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085457.1-1335s21c1
Sequence:CCGGATAAGTTTCTACTGGGTATATCTCGAGATATACCCAGTAGAAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085457
CBWD6 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-238s21c1
Sequence:CCGGCACAATTATCACCGGGTATTTCTCGAGAAATACCCGGTGATAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-567s21c1
Sequence:CCGGCCGAATTAGGGAGTGATATTTCTCGAGAAATATCACTCCCTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-591s21c1
Sequence:CCGGTTGATGGTATCATAACTATTGCTCGAGCAATAGTTATGATACCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085457.1-756s21c1
Sequence:CCGGGAACGACACTTAGATCCATAACTCGAGTTATGGATCTAAGTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085457.1-1335s21c1
Sequence:CCGGATAAGTTTCTACTGGGTATATCTCGAGATATACCCAGTAGAAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks