EMAIL THIS PAGE TO A FRIEND

CBX1

chromobox homolog 1

179 Gene Product Result for
Synonyms: CBX HP1-BETA HP1Hs-beta HP1Hsbeta M31 MOD1 p25beta
UniProtKB ID: P83916, P23197
Gene ID:
Human(10951) Summary: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family . The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The protein may play an important role in the epigenetic control of chromatin structure and gene expression. Several related pseudogenes are located on chromosomes 1, 3, and X. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(12412) chromobox 1
Rat(360609) chromobox homolog 1
naked mole-rat(101706928) chromobox homolog 1
domestic guinea pig(100716439) chromobox homolog 1
sheep(101116158) chromobox homolog 1
chicken(374237) chromobox homolog 1
domestic cat(101084070) chromobox homolog 1
cow(616506) chromobox homolog 1
dog(491051) chromobox homolog 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34427 Anti-CBX1 antibody produced in rabbit IgG fraction of antiserum rabbit, canine, guinea pig, horse, human, rat, mouse, bovine,
western blot pricing
SAB2104638 Anti-CBX1, (N-terminal) antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rabbit, horse, canine, human, rat
western blot pricing
SAB2500207 Anti-CBX1/HP1-β antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
ELISA, immunohistochemistry, western blot pricing
H2039 Anti-HP1β antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing
PLA0005 Goat anti-HP1-beta Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, horse, bovine, guinea pig, gorilla, pig, human, rabbit, primate, chimpanzee, dog, rhesus monkey
proximity ligation assay, western blot pricing
SAB5300331 Monoclonal Anti-CBX1 antibody produced in mouse clone 5A3, ascites fluid monkey, human
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB1402535 Monoclonal Anti-CBX1 antibody produced in mouse clone 4E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110901 MISSION® esiRNA esiRNA human CBX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127228 Rosetta Predictions human pricing
NM_006807 Rosetta Predictions human pricing
XM_001081346 Rosetta Predictions rat pricing
XM_340885 Rosetta Predictions rat pricing
NM_007622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328927 predicted 1003
2 SASI_Hs02_00328928 predicted 943
3 SASI_Hs02_00328929 predicted 631
4 SASI_Hs02_00328930 predicted 912
5 SASI_Hs02_00328931 predicted 545
6 SASI_Hs02_00328932 predicted 622
7 SASI_Hs02_00328933 predicted 542
8 SASI_Hs02_00328934 predicted 985
9 SASI_Hs02_00328935 predicted 510
10 SASI_Hs02_00328936 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342328 predicted 1195
2 SASI_Hs02_00342329 predicted 1137
3 SASI_Hs01_00228889 predicted 823
4 SASI_Hs01_00228890 predicted 1098
5 SASI_Hs01_00228891 predicted 727
6 SASI_Hs02_00342330 predicted 809
7 SASI_Hs02_00342331 predicted 725
8 SASI_Hs02_00342332 predicted 1182
9 SASI_Hs02_00342333 predicted 699
10 SASI_Hs02_00342334 predicted 817
11 SASI_Hs01_00228885 predicted 311
12 SASI_Hs01_00228886 predicted 482
13 SASI_Hs01_00228887 predicted 757
14 SASI_Hs01_00228888 predicted 481
15 SASI_Hs01_00228892 predicted 388
16 SASI_Hs01_00228893 predicted 477
17 SASI_Hs01_00228894 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371554 predicted 581
2 SASI_Rn02_00371555 predicted 1374
3 SASI_Rn02_00371556 predicted 1358
4 SASI_Rn02_00371557 predicted 1220
5 SASI_Rn02_00371558 predicted 647
6 SASI_Rn02_00371559 predicted 601
7 SASI_Rn02_00371560 predicted 920
8 SASI_Rn02_00371561 predicted 993
9 SASI_Rn02_00371562 predicted 927
10 SASI_Rn02_00371563 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392070 predicted 1534
2 SASI_Rn02_00392071 predicted 2321
3 SASI_Rn02_00392072 predicted 1602
4 SASI_Rn02_00392073 predicted 422
5 SASI_Rn02_00392074 predicted 1872
6 SASI_Rn02_00392075 predicted 1941
7 SASI_Rn02_00392076 predicted 1239
8 SASI_Rn02_00392077 predicted 1372
9 SASI_Rn02_00392078 predicted 1802
10 SASI_Rn02_00392079 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101956 predicted 725
2 SASI_Mm01_00101957 predicted 448
3 SASI_Mm01_00101958 predicted 542
4 SASI_Mm01_00101960 predicted 843
5 SASI_Mm01_00101961 predicted 736
6 SASI_Mm01_00101963 predicted 612
7 SASI_Mm01_00101964 predicted 290
8 SASI_Mm01_00101965 predicted 881
9 SASI_Mm02_00312080 predicted 737
10 SASI_Mm02_00312081 predicted 592
11 SASI_Mm01_00101959 predicted 420
12 SASI_Mm01_00101962 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006807
VALIDATED
CBX1 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1448s21c1
Sequence:GTACCGGTGGCTATTACTGGTGTATTATCTCGAGATAATACACCAGTAATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-949s21c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-595s21c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-662s21c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-533s21c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1175s21c1
Sequence:GTACCGGGCAGCAGCCCAAGTGCTTTAACTCGAGTTAAAGCACTTGGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006807.3-396s1c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-334s1c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-750s1c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-463s1c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006807
VALIDATED
CBX1 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1448s21c1
Sequence:GTACCGGTGGCTATTACTGGTGTATTATCTCGAGATAATACACCAGTAATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-949s21c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-595s21c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-662s21c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-533s21c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1175s21c1
Sequence:GTACCGGGCAGCAGCCCAAGTGCTTTAACTCGAGTTAAAGCACTTGGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006807.3-396s1c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-334s1c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-750s1c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-463s1c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006807
VALIDATED
CBX1 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1448s21c1
Sequence:GTACCGGTGGCTATTACTGGTGTATTATCTCGAGATAATACACCAGTAATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-949s21c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-595s21c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-662s21c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006807.4-533s21c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006807.4-1175s21c1
Sequence:GTACCGGGCAGCAGCCCAAGTGCTTTAACTCGAGTTAAAGCACTTGGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006807.3-396s1c1
Sequence:CCGGCCTCCTAAAGTGGAAGGGATTCTCGAGAATCCCTTCCACTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-334s1c1
Sequence:CCGGGAAGAGGAATATGTGGTGGAACTCGAGTTCCACCACATATTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-750s1c1
Sequence:CCGGCCCACAGGTTGTCATATCCTTCTCGAGAAGGATATGACAACCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006807.3-463s1c1
Sequence:CCGGCCCGACCTCATTGCTGAGTTTCTCGAGAAACTCAGCAATGAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007622
VALIDATED
CBX1 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-436s21c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-611s21c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-451s21c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-806s21c1
Sequence:CCGGAGAATTAGCCCTGTCTTCTTCCTCGAGGAAGAAGACAGGGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-369s21c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-412s1c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-265s1c1
Sequence:CCGGGAGGTACTAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-345s1c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-587s1c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-427s1c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007622
VALIDATED
CBX1 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-436s21c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-611s21c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-451s21c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-806s21c1
Sequence:CCGGAGAATTAGCCCTGTCTTCTTCCTCGAGGAAGAAGACAGGGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-369s21c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-412s1c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-265s1c1
Sequence:CCGGGAGGTACTAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-345s1c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-587s1c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-427s1c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007622
VALIDATED
CBX1 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-436s21c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-611s21c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-451s21c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007622.3-806s21c1
Sequence:CCGGAGAATTAGCCCTGTCTTCTTCCTCGAGGAAGAAGACAGGGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007622.3-369s21c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-412s1c1
Sequence:CCGGCCTGACCTTATTGCTGAGTTTCTCGAGAAACTCAGCAATAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-265s1c1
Sequence:CCGGGAGGTACTAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007622.2-345s1c1
Sequence:CCGGTCTTCTAAAGTGGAAGGGTTTCTCGAGAAACCCTTCCACTTTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-587s1c1
Sequence:CCGGCAGAGCGGATTATTGGAGCTACTCGAGTAGCTCCAATAATCCGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007622.2-427s1c1
Sequence:CCGGGAGTTTCTACAGTCACAGAAACTCGAGTTTCTGTGACTGTAGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks