EMAIL THIS PAGE TO A FRIEND

CBX2

chromobox homolog 2

62 Gene Product Result for
Synonyms: CDCA6 M33 SRXY5
UniProtKB ID: Q14781, Q0VDA5, Q9BTB1
Gene ID:
Human(84733) Summary: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in mice results in male-to-female gonadal sex reversal. Mutations in this gene are also associated with gonadal dysgenesis in humans. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2010]
Mouse(12416) chromobox 2
Rat(303730) chromobox homolog 2
Zebrafish(327291) chromobox homolog 2 (Drosophila Pc class)
chicken(426248) chromobox homolog 2
cow(506628) chromobox homolog 2
domestic cat(101085589) chromobox homolog 2
dog(483349) chromobox homolog 2
sheep(101111469) chromobox homolog 2
domestic guinea pig(100727193) chromobox homolog 2
naked mole-rat(101713651) chromobox homolog 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032647 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005189 Rosetta Predictions human pricing
NM_032647 Rosetta Predictions human pricing
NM_001107071 Rosetta Predictions rat pricing
NM_007623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048440 predicted 1548
2 SASI_Hs01_00048441 predicted 1110
3 SASI_Hs01_00048442 predicted 1567
4 SASI_Hs01_00048443 predicted 1829
5 SASI_Hs01_00048444 predicted 1535
6 SASI_Hs01_00048445 predicted 674
7 SASI_Hs02_00339137 predicted 799
8 SASI_Hs01_00048446 predicted 750
9 SASI_Hs01_00048447 predicted 1525
10 SASI_Hs01_00048448 predicted 726
11 SASI_Hs01_00048449 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190086 predicted 275
2 SASI_Hs01_00190087 predicted 441
3 SASI_Hs01_00190088 predicted 587
4 SASI_Hs01_00190089 predicted 662
5 SASI_Hs01_00190090 predicted 770
6 SASI_Hs01_00190091 predicted 430
7 SASI_Hs01_00190092 predicted 658
8 SASI_Hs01_00190093 predicted 425
9 SASI_Hs01_00190094 predicted 834
10 SASI_Hs01_00190095 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225206 predicted 1999
2 SASI_Rn02_00225207 predicted 525
3 SASI_Rn02_00225208 predicted 701
4 SASI_Rn02_00225209 predicted 2025
5 SASI_Rn02_00225210 predicted 2031
6 SASI_Rn02_00225211 predicted 806
7 SASI_Rn02_00225212 predicted 2101
8 SASI_Rn02_00225213 predicted 524
9 SASI_Rn02_00225214 predicted 2042
10 SASI_Rn02_00225215 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164595 predicted 541
2 SASI_Mm02_00312082 predicted 1614
3 SASI_Mm01_00164596 predicted 1527
4 SASI_Mm01_00164598 predicted 1316
5 SASI_Mm01_00164599 predicted 1617
6 SASI_Mm01_00164600 predicted 918
7 SASI_Mm01_00164601 predicted 368
8 SASI_Mm01_00164602 predicted 544
9 SASI_Mm01_00164603 predicted 1489
10 SASI_Mm01_00164604 predicted 1084
11 SASI_Mm01_00164597 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007623
VALIDATED
CBX2 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-848s1c1
Sequence:CCGGCGTACACTACATGAACCGCATCTCGAGATGCGGTTCATGTAGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-182s1c1
Sequence:CCGGCGGCTGGTCCTCCAAACACAACTCGAGTTGTGTTTGGAGGACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-1481s1c1
Sequence:CCGGGCAGAACCTATCTGTAGCTATCTCGAGATAGCTACAGATAGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-1251s1c1
Sequence:CCGGGCTCCCACAGACAACAACAAACTCGAGTTTGTTGTTGTCTGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-2110s1c1
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1618s21c1
Sequence:CCGGTCTTCAACTTGAGGCATTATTCTCGAGAATAATGCCTCAAGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-544s21c1
Sequence:CCGGCAGAGCTGAAGGATCCCATTACTCGAGTAATGGGATCCTTCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1317s21c1
Sequence:CCGGGTCAAGCGGGACACCGTTAAACTCGAGTTTAACGGTGTCCCGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1534s21c1
Sequence:CCGGGTCTCATCGAACACGTCTTTGCTCGAGCAAAGACGTGTTCGATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007623.2-2110s21c2
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007623
VALIDATED
CBX2 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-848s1c1
Sequence:CCGGCGTACACTACATGAACCGCATCTCGAGATGCGGTTCATGTAGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-182s1c1
Sequence:CCGGCGGCTGGTCCTCCAAACACAACTCGAGTTGTGTTTGGAGGACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-1481s1c1
Sequence:CCGGGCAGAACCTATCTGTAGCTATCTCGAGATAGCTACAGATAGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-1251s1c1
Sequence:CCGGGCTCCCACAGACAACAACAAACTCGAGTTTGTTGTTGTCTGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-2110s1c1
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1618s21c1
Sequence:CCGGTCTTCAACTTGAGGCATTATTCTCGAGAATAATGCCTCAAGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-544s21c1
Sequence:CCGGCAGAGCTGAAGGATCCCATTACTCGAGTAATGGGATCCTTCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1317s21c1
Sequence:CCGGGTCAAGCGGGACACCGTTAAACTCGAGTTTAACGGTGTCCCGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1534s21c1
Sequence:CCGGGTCTCATCGAACACGTCTTTGCTCGAGCAAAGACGTGTTCGATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007623.2-2110s21c2
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007623
VALIDATED
CBX2 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-848s1c1
Sequence:CCGGCGTACACTACATGAACCGCATCTCGAGATGCGGTTCATGTAGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-182s1c1
Sequence:CCGGCGGCTGGTCCTCCAAACACAACTCGAGTTGTGTTTGGAGGACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-1481s1c1
Sequence:CCGGGCAGAACCTATCTGTAGCTATCTCGAGATAGCTACAGATAGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007623.2-1251s1c1
Sequence:CCGGGCTCCCACAGACAACAACAAACTCGAGTTTGTTGTTGTCTGTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007623.2-2110s1c1
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1618s21c1
Sequence:CCGGTCTTCAACTTGAGGCATTATTCTCGAGAATAATGCCTCAAGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-544s21c1
Sequence:CCGGCAGAGCTGAAGGATCCCATTACTCGAGTAATGGGATCCTTCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1317s21c1
Sequence:CCGGGTCAAGCGGGACACCGTTAAACTCGAGTTTAACGGTGTCCCGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007623.2-1534s21c1
Sequence:CCGGGTCTCATCGAACACGTCTTTGCTCGAGCAAAGACGTGTTCGATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007623.2-2110s21c2
Sequence:CCGGGCGGAAATCTTCAGTCTCTATCTCGAGATAGAGACTGAAGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032647
CBX2 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-211s1c1
Sequence:CCGGGCCTTCCAGAAGAAGGAACATCTCGAGATGTTCCTTCTTCTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-279s1c1
Sequence:CCGGGCCAAGGAAGCTCACTGCCATCTCGAGATGGCAGTGAGCTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-657s1c1
Sequence:CCGGACAGGAAGCATGCGTACAGTACTCGAGTACTGTACGCATGCTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-81s1c1
Sequence:CCGGCGCCGAGTGCATCCTGAGCAACTCGAGTTGCTCAGGATGCACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-647s1c1
Sequence:CCGGACGGAAAGGAACAGGAAGCATCTCGAGATGCTTCCTGTTCCTTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-120s21c1
Sequence:CCGGGCTGGAGTACCTGGTCAAGTGCTCGAGCACTTGACCAGGTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032647.2-760s21c1
Sequence:CCGGTAAATCGAGGTGGCCACGAAACTCGAGTTTCGTGGCCACCTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-668s21c1
Sequence:CCGGGCGTACAGTAGGTGCTCATAGCTCGAGCTATGAGCACCTACTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-595s21c1
Sequence:CCGGGGGTCAAACTGCTGCAGACAACTCGAGTTGTCTGCAGCAGTTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-444s21c1
Sequence:CCGGGTCTGTCCCTCTACTCGGAAACTCGAGTTTCCGAGTAGAGGGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-145s21c1
Sequence:CCGGGGCTGGTCCTCCAAACATAACCTCGAGGTTATGTTTGGAGGACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-154s21c1
Sequence:CCGGTCCAAACATAACAGCTGGGAGCTCGAGCTCCCAGCTGTTATGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-226s21c1
Sequence:CCGGGAACATGAGAAGGAGGTGCAGCTCGAGCTGCACCTCCTTCTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-217s21c1
Sequence:CCGGCAGAAGAAGGAACATGAGAAGCTCGAGCTTCTCATGTTCCTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-655s21c1
Sequence:CCGGGAACAGGAAGCATGCGTACAGCTCGAGCTGTACGCATGCTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-430s21c1
Sequence:CCGGCACTTCTGCCAACAGTCTGTCCTCGAGGACAGACTGTTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-238s21c1
Sequence:CCGGGAGGTGCAGAACCGGAAGAGACTCGAGTCTCTTCCGGTTCTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-480s21c1
Sequence:CCGGCTTCCTGTCTCTCAGCTTCTGCTCGAGCAGAAGCTGAGAGACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032647
CBX2 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-211s1c1
Sequence:CCGGGCCTTCCAGAAGAAGGAACATCTCGAGATGTTCCTTCTTCTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-279s1c1
Sequence:CCGGGCCAAGGAAGCTCACTGCCATCTCGAGATGGCAGTGAGCTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-657s1c1
Sequence:CCGGACAGGAAGCATGCGTACAGTACTCGAGTACTGTACGCATGCTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-81s1c1
Sequence:CCGGCGCCGAGTGCATCCTGAGCAACTCGAGTTGCTCAGGATGCACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-647s1c1
Sequence:CCGGACGGAAAGGAACAGGAAGCATCTCGAGATGCTTCCTGTTCCTTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-120s21c1
Sequence:CCGGGCTGGAGTACCTGGTCAAGTGCTCGAGCACTTGACCAGGTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032647.2-760s21c1
Sequence:CCGGTAAATCGAGGTGGCCACGAAACTCGAGTTTCGTGGCCACCTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-668s21c1
Sequence:CCGGGCGTACAGTAGGTGCTCATAGCTCGAGCTATGAGCACCTACTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-595s21c1
Sequence:CCGGGGGTCAAACTGCTGCAGACAACTCGAGTTGTCTGCAGCAGTTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-444s21c1
Sequence:CCGGGTCTGTCCCTCTACTCGGAAACTCGAGTTTCCGAGTAGAGGGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-145s21c1
Sequence:CCGGGGCTGGTCCTCCAAACATAACCTCGAGGTTATGTTTGGAGGACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-154s21c1
Sequence:CCGGTCCAAACATAACAGCTGGGAGCTCGAGCTCCCAGCTGTTATGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-226s21c1
Sequence:CCGGGAACATGAGAAGGAGGTGCAGCTCGAGCTGCACCTCCTTCTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-217s21c1
Sequence:CCGGCAGAAGAAGGAACATGAGAAGCTCGAGCTTCTCATGTTCCTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-655s21c1
Sequence:CCGGGAACAGGAAGCATGCGTACAGCTCGAGCTGTACGCATGCTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-430s21c1
Sequence:CCGGCACTTCTGCCAACAGTCTGTCCTCGAGGACAGACTGTTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-238s21c1
Sequence:CCGGGAGGTGCAGAACCGGAAGAGACTCGAGTCTCTTCCGGTTCTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-480s21c1
Sequence:CCGGCTTCCTGTCTCTCAGCTTCTGCTCGAGCAGAAGCTGAGAGACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032647
CBX2 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-211s1c1
Sequence:CCGGGCCTTCCAGAAGAAGGAACATCTCGAGATGTTCCTTCTTCTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-279s1c1
Sequence:CCGGGCCAAGGAAGCTCACTGCCATCTCGAGATGGCAGTGAGCTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-657s1c1
Sequence:CCGGACAGGAAGCATGCGTACAGTACTCGAGTACTGTACGCATGCTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-81s1c1
Sequence:CCGGCGCCGAGTGCATCCTGAGCAACTCGAGTTGCTCAGGATGCACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032647.2-647s1c1
Sequence:CCGGACGGAAAGGAACAGGAAGCATCTCGAGATGCTTCCTGTTCCTTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-120s21c1
Sequence:CCGGGCTGGAGTACCTGGTCAAGTGCTCGAGCACTTGACCAGGTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032647.2-760s21c1
Sequence:CCGGTAAATCGAGGTGGCCACGAAACTCGAGTTTCGTGGCCACCTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-668s21c1
Sequence:CCGGGCGTACAGTAGGTGCTCATAGCTCGAGCTATGAGCACCTACTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-595s21c1
Sequence:CCGGGGGTCAAACTGCTGCAGACAACTCGAGTTGTCTGCAGCAGTTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-444s21c1
Sequence:CCGGGTCTGTCCCTCTACTCGGAAACTCGAGTTTCCGAGTAGAGGGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-145s21c1
Sequence:CCGGGGCTGGTCCTCCAAACATAACCTCGAGGTTATGTTTGGAGGACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-154s21c1
Sequence:CCGGTCCAAACATAACAGCTGGGAGCTCGAGCTCCCAGCTGTTATGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-226s21c1
Sequence:CCGGGAACATGAGAAGGAGGTGCAGCTCGAGCTGCACCTCCTTCTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-217s21c1
Sequence:CCGGCAGAAGAAGGAACATGAGAAGCTCGAGCTTCTCATGTTCCTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-655s21c1
Sequence:CCGGGAACAGGAAGCATGCGTACAGCTCGAGCTGTACGCATGCTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-430s21c1
Sequence:CCGGCACTTCTGCCAACAGTCTGTCCTCGAGGACAGACTGTTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-238s21c1
Sequence:CCGGGAGGTGCAGAACCGGAAGAGACTCGAGTCTCTTCCGGTTCTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032647.2-480s21c1
Sequence:CCGGCTTCCTGTCTCTCAGCTTCTGCTCGAGCAGAAGCTGAGAGACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks