EMAIL THIS PAGE TO A FRIEND

CBX3

chromobox homolog 3

138 Gene Product Result for
Synonyms: HECH HP1-GAMMA HP1Hs-gamma
UniProtKB ID: Q13185, Q96CD7, Q99409, Q9BVS3, Q9P0Z6
Gene ID:
Human(11335) Summary: At the nuclear envelope, the nuclear lamina and heterochromatin are adjacent to the inner nuclear membrane. The protein encoded by this gene binds DNA and is a component of heterochromatin. This protein also can bind lamin B receptor, an integral membrane protein found in the inner nuclear membrane. The dual binding functions of the encoded protein may explain the association of heterochromatin with the inner nuclear membrane. This protein binds histone H3 tails methylated at Lys-9 sites. This protein is also recruited to sites of ultraviolet-induced DNA damage and double-strand breaks. Two transcript variants encoding the same protein but differing in the 5' UTR, have been found for this gene.[provided by RefSeq, Mar 2011]
Mouse(12417) chromobox 3
Rat(297093) chromobox homolog 3
naked mole-rat(101714000) chromobox homolog 3
domestic guinea pig(100714020) chromobox homolog 3
sheep(101106931) chromobox homolog 3
chicken(395355) chromobox homolog 3
dog(482015) chromobox homolog 3
cow(539788) chromobox homolog 3
domestic cat(101099363) chromobox homolog 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004902 Anti-CBX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV34722 Anti-CBX3 antibody produced in rabbit affinity isolated antibody mouse, rat, horse, rabbit, bovine, canine, human, guinea pig,
western blot pricing
AV34721 Anti-CBX3 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, human, rat, rabbit, horse, canine, mouse
immunohistochemistry, western blot pricing
SAB2500208 Anti-CBX3/HP1γ antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500253 Anti-HP1 γ antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504668 Anti-phospho-HP1 γ (pSer93) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301327 Anti-phospho-HP1γ (pSer93) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0011335M1 Monoclonal Anti-CBX3 antibody produced in mouse clone 1G12-1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404931 Monoclonal Anti-CBX3 antibody produced in mouse clone S3, ascites fluid human
ELISA, western blot pricing
PLA0160 Rabbit anti-CBX3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, rabbit, toad, turkey, rat, horse, human, guinea pig, chicken, bovine, dog, toad
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABE1329 Anti-Chromobox protein homolog 3 Antibody 100 µg, This Anti-Chromobox protein homolog 3 antibody is validated for use in WB, IC;IP for the detection of Chromobox protein homolog 3. pricing
MAB3450 Anti-Heterochromatin Protein-1 gamma Antibody, clone 2MOD-1G6 100 µL, Anti-Heterochromatin Protein-1 gamma Antibody, clone 2MOD-1G6 is a Mouse Monoclonal Antibody for detection of Heterochromatin Protein-1 gamma also known as HP-1gamma & has been validated in ELISA, ICC, IF, IHC & WB. pricing
MABE656 Anti-HP1γ Antibody, clone 14D3.1 100 μg, Anti-HP1γ, clone 14D3.1, Cat. No. MABE656, is a highly specific mouse monoclonal antibody that targets heterochromatin protein-1 gamma and has been tested in Immunocytochemistry and Western Blotting. pricing
05-690 Anti-HP1γ Antibody, clone 42s2 200 µg, Use Anti-HP1γ Antibody, clone 42s2 (Mouse Monoclonal Antibody) validated in ChIP, IHC, WB to detect HP1γ also known as Heterochromatin protein 1 homolog gamma. pricing
07-972 Anti-phospho-HP1 γ (Ser83) Antibody 100 µg, Anti-phospho-HP1 γ (Ser83) Antibody is a Rabbit Polyclonal Antibody for detection of phospho-HP1 γ (Ser83) also known as Heterochromatin protein 1 homolog gamma, HECH & has been validated in WB. pricing
17-646 ChIPAb+ HP1γ - ChIP Validated Antibody and Primer Set 25 assays, This ChIPAb+ HP1γ -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007276 Rosetta Predictions human pricing
NM_016587 Rosetta Predictions human pricing
NM_001008313 Rosetta Predictions rat pricing
NM_007624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170890 predicted 444
2 SASI_Hs02_00343330 predicted 394
3 SASI_Hs01_00170891 predicted 451
4 SASI_Hs01_00170892 predicted 571
5 SASI_Hs01_00170894 predicted 343
6 SASI_Hs01_00170895 predicted 327
7 SASI_Hs01_00170896 predicted 311
8 SASI_Hs01_00170897 predicted 186
9 SASI_Hs01_00170898 predicted 212
10 SASI_Hs02_00343331 predicted 504
11 SASI_Hs01_00170889 predicted 388
12 SASI_Hs01_00170893 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196532 predicted 482
2 SASI_Hs02_00349719 predicted 440
3 SASI_Hs01_00196533 predicted 489
4 SASI_Hs01_00196534 predicted 610
5 SASI_Hs01_00196536 predicted 384
6 SASI_Hs01_00196537 predicted 369
7 SASI_Hs01_00196538 predicted 353
8 SASI_Hs01_00196539 predicted 224
9 SASI_Hs01_00196540 predicted 253
10 SASI_Hs02_00349720 predicted 552
11 SASI_Hs01_00196531 predicted 427
12 SASI_Hs01_00196535 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199041 predicted 268
2 SASI_Rn02_00199042 predicted 223
3 SASI_Rn02_00199043 predicted 362
4 SASI_Rn02_00199044 predicted 356
5 SASI_Rn02_00199045 predicted 333
6 SASI_Rn02_00199046 predicted 219
7 SASI_Rn02_00199047 predicted 820
8 SASI_Rn02_00199048 predicted 826
9 SASI_Rn02_00199049 predicted 865
10 SASI_Rn02_00199050 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312083 predicted 420
2 SASI_Mm01_00020546 predicted 880
3 SASI_Mm02_00312084 predicted 359
4 SASI_Mm02_00312085 predicted 308
5 SASI_Mm02_00312086 predicted 552
6 SASI_Mm02_00312087 predicted 612
7 SASI_Mm02_00312088 predicted 229
8 SASI_Mm01_00020550 predicted 827
9 SASI_Mm01_00020551 predicted 890
10 SASI_Mm02_00312089 predicted 635
11 SASI_Mm01_00020547 predicted 916
12 SASI_Mm01_00020548 predicted 874
13 SASI_Mm01_00020549 predicted 919
14 SASI_Mm01_00020552 predicted 894
15 SASI_Mm01_00020553 predicted 888
16 SASI_Mm01_00020554 predicted 832
17 SASI_Mm01_00020555 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007276
VALIDATED
CBX3 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-1145s21c1
Sequence:CCGGGTTTCTGAGATGCCATTATTCCTCGAGGAATAATGGCATCTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-223s21c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-334s21c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-901s21c1
Sequence:CCGGGATACCATGGTATATCATTTCCTCGAGGAAATGATATACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-565s21c1
Sequence:CCGGCTGGCGAAAGAGGCAAATATGCTCGAGCATATTTGCCTCTTTCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-956s21c1
Sequence:CCGGGGGAAATGTCCATAGTCATTACTCGAGTAATGACTATGGACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-1006s21c1
Sequence:CCGGTAAGGACCATTCTAGATTTATCTCGAGATAAATCTAGAATGGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-223s1c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-334s1c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007276.3-319s1c1
Sequence:CCGGCCAGAATTGATTGAAGCGTTTCTCGAGAAACGCTTCAATCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-577s1c1
Sequence:CCGGGCAAATATGAAGTGTCCTCAACTCGAGTTGAGGACACTTCATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-190s1c1
Sequence:CCGGCCTGAAGAATTTGTCGTGGAACTCGAGTTCCACGACAAATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007276
VALIDATED
CBX3 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-1145s21c1
Sequence:CCGGGTTTCTGAGATGCCATTATTCCTCGAGGAATAATGGCATCTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-223s21c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-334s21c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-901s21c1
Sequence:CCGGGATACCATGGTATATCATTTCCTCGAGGAAATGATATACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-565s21c1
Sequence:CCGGCTGGCGAAAGAGGCAAATATGCTCGAGCATATTTGCCTCTTTCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-956s21c1
Sequence:CCGGGGGAAATGTCCATAGTCATTACTCGAGTAATGACTATGGACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-1006s21c1
Sequence:CCGGTAAGGACCATTCTAGATTTATCTCGAGATAAATCTAGAATGGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-223s1c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-334s1c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007276.3-319s1c1
Sequence:CCGGCCAGAATTGATTGAAGCGTTTCTCGAGAAACGCTTCAATCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-577s1c1
Sequence:CCGGGCAAATATGAAGTGTCCTCAACTCGAGTTGAGGACACTTCATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-190s1c1
Sequence:CCGGCCTGAAGAATTTGTCGTGGAACTCGAGTTCCACGACAAATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007276
VALIDATED
CBX3 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-1145s21c1
Sequence:CCGGGTTTCTGAGATGCCATTATTCCTCGAGGAATAATGGCATCTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-223s21c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007276.3-334s21c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007276.3-901s21c1
Sequence:CCGGGATACCATGGTATATCATTTCCTCGAGGAAATGATATACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-565s21c1
Sequence:CCGGCTGGCGAAAGAGGCAAATATGCTCGAGCATATTTGCCTCTTTCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-956s21c1
Sequence:CCGGGGGAAATGTCCATAGTCATTACTCGAGTAATGACTATGGACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007276.3-1006s21c1
Sequence:CCGGTAAGGACCATTCTAGATTTATCTCGAGATAAATCTAGAATGGTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-223s1c1
Sequence:CCGGCGACGTGTAGTGAATGGGAAACTCGAGTTTCCCATTCACTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-334s1c1
Sequence:CCGGGCGTTTCTTAACTCTCAGAAACTCGAGTTTCTGAGAGTTAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007276.3-319s1c1
Sequence:CCGGCCAGAATTGATTGAAGCGTTTCTCGAGAAACGCTTCAATCAATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-577s1c1
Sequence:CCGGGCAAATATGAAGTGTCCTCAACTCGAGTTGAGGACACTTCATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007276.3-190s1c1
Sequence:CCGGCCTGAAGAATTTGTCGTGGAACTCGAGTTCCACGACAAATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007624
VALIDATED
CBX3 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-513s21c1
Sequence:CCGGTCTCGACCCTGAACGAATAATCTCGAGATTATTCGTTCAGGGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-833s21c1
Sequence:CCGGTTGACAGTAGTTGGGATATTTCTCGAGAAATATCCCAACTACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-542s21c1
Sequence:CCGGCAGACAGCAGCGGAGAGTTAACTCGAGTTAACTCTCCGCTGCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-276s21c1
Sequence:CCGGGAATGGGAAGGTGGAGTATTTCTCGAGAAATACTCCACCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007624.3-311s21c1
Sequence:CCGGGGTTCACAGATGCTGATAATACTCGAGTATTATCAGCATCTGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-369s1c1
Sequence:CCGGCGGAGAGTTAATGTTTCTCATCTCGAGATGAGAAACATTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-176s1c1
Sequence:CCGGGTCCAGAATTAATTGAAGACTCTCGAGAGTCTTCAATTAATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-136s1c1
Sequence:CCGGGATGCTGATAATACTTGGGAACTCGAGTTCCCAAGTATTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-254s1c1
Sequence:CCGGCTGACAGTGAATCTGATGATACTCGAGTATCATCAGATTCACTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-49s1c1
Sequence:CCGGCCTGAAGAATTTGTGGTAGAACTCGAGTTCTACCACAAATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007624
VALIDATED
CBX3 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-513s21c1
Sequence:CCGGTCTCGACCCTGAACGAATAATCTCGAGATTATTCGTTCAGGGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-833s21c1
Sequence:CCGGTTGACAGTAGTTGGGATATTTCTCGAGAAATATCCCAACTACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-542s21c1
Sequence:CCGGCAGACAGCAGCGGAGAGTTAACTCGAGTTAACTCTCCGCTGCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-276s21c1
Sequence:CCGGGAATGGGAAGGTGGAGTATTTCTCGAGAAATACTCCACCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007624.3-311s21c1
Sequence:CCGGGGTTCACAGATGCTGATAATACTCGAGTATTATCAGCATCTGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-369s1c1
Sequence:CCGGCGGAGAGTTAATGTTTCTCATCTCGAGATGAGAAACATTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-176s1c1
Sequence:CCGGGTCCAGAATTAATTGAAGACTCTCGAGAGTCTTCAATTAATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-136s1c1
Sequence:CCGGGATGCTGATAATACTTGGGAACTCGAGTTCCCAAGTATTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-254s1c1
Sequence:CCGGCTGACAGTGAATCTGATGATACTCGAGTATCATCAGATTCACTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-49s1c1
Sequence:CCGGCCTGAAGAATTTGTGGTAGAACTCGAGTTCTACCACAAATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007624
VALIDATED
CBX3 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-513s21c1
Sequence:CCGGTCTCGACCCTGAACGAATAATCTCGAGATTATTCGTTCAGGGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-833s21c1
Sequence:CCGGTTGACAGTAGTTGGGATATTTCTCGAGAAATATCCCAACTACTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-542s21c1
Sequence:CCGGCAGACAGCAGCGGAGAGTTAACTCGAGTTAACTCTCCGCTGCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007624.3-276s21c1
Sequence:CCGGGAATGGGAAGGTGGAGTATTTCTCGAGAAATACTCCACCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007624.3-311s21c1
Sequence:CCGGGGTTCACAGATGCTGATAATACTCGAGTATTATCAGCATCTGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-369s1c1
Sequence:CCGGCGGAGAGTTAATGTTTCTCATCTCGAGATGAGAAACATTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-176s1c1
Sequence:CCGGGTCCAGAATTAATTGAAGACTCTCGAGAGTCTTCAATTAATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-136s1c1
Sequence:CCGGGATGCTGATAATACTTGGGAACTCGAGTTCCCAAGTATTATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-254s1c1
Sequence:CCGGCTGACAGTGAATCTGATGATACTCGAGTATCATCAGATTCACTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007624.1-49s1c1
Sequence:CCGGCCTGAAGAATTTGTGGTAGAACTCGAGTTCTACCACAAATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks