EMAIL THIS PAGE TO A FRIEND

CBX4

chromobox homolog 4

114 Gene Product Result for
Synonyms: NBP16 PC2
UniProtKB ID: O00257, B1PJR7, Q6TPI8, Q96C04
Gene ID:
Mouse(12418) chromobox 4
Rat(501403) chromobox homolog 4
Zebrafish(573110) chromobox homolog 4 (Pc class homolog, Drosophila)
chicken(395354) chromobox homolog 4
cow(767865) chromobox homolog 4
dog(608556) chromobox homolog 4
naked mole-rat(101715523) chromobox homolog 4
domestic guinea pig(100732734) chromobox homolog 4
sheep(101110952) chromobox homolog 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003655 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047031 MISSION® esiRNA esiRNA targeting mouse Cbx4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003655 Rosetta Predictions human pricing
XM_001081757 Rosetta Predictions rat pricing
XM_576815 Rosetta Predictions rat pricing
NM_007625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079774 predicted 940
2 SASI_Hs01_00079776 predicted 587
3 SASI_Hs02_00336031 predicted 587
4 SASI_Hs01_00079778 predicted 346
5 SASI_Hs01_00079779 predicted 878
6 SASI_Hs01_00079780 predicted 605
7 SASI_Hs01_00079781 predicted 603
8 SASI_Hs01_00079782 predicted 402
9 SASI_Hs01_00079783 predicted 935
10 SASI_Hs02_00336032 predicted 879
11 SASI_Hs01_00079775 predicted 978
12 SASI_Hs01_00079777 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373325 predicted 1448
2 SASI_Rn02_00373326 predicted 629
3 SASI_Rn02_00373327 predicted 612
4 SASI_Rn02_00373328 predicted 624
5 SASI_Rn02_00373329 predicted 752
6 SASI_Rn02_00373330 predicted 627
7 SASI_Rn02_00373331 predicted 535
8 SASI_Rn02_00373332 predicted 552
9 SASI_Rn02_00373333 predicted 1142
10 SASI_Rn02_00373334 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405904 predicted 628
2 SASI_Rn02_00405905 predicted 1007
3 SASI_Rn02_00405906 predicted 627
4 SASI_Rn02_00405907 predicted 1703
5 SASI_Rn02_00405908 predicted 1679
6 SASI_Rn02_00405909 predicted 1499
7 SASI_Rn02_00405910 predicted 744
8 SASI_Rn02_00405911 predicted 530
9 SASI_Rn02_00405912 predicted 547
10 SASI_Rn02_00405913 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312090 predicted 1833
2 SASI_Mm01_00178370 predicted 585
3 SASI_Mm01_00178371 predicted 1769
4 SASI_Mm01_00178372 predicted 1969
5 SASI_Mm02_00312091 predicted 1825
6 SASI_Mm01_00178373 predicted 405
7 SASI_Mm01_00178374 predicted 1887
8 SASI_Mm01_00178375 predicted 1619
9 SASI_Mm01_00178377 predicted 531
10 SASI_Mm02_00312092 predicted 661
11 SASI_Mm01_00178369 predicted 1743
12 SASI_Mm01_00178376 predicted 356
13 SASI_Mm01_00178378 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007625
VALIDATED
CBX4 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007625.1-2336s1c1
Sequence:CCGGCGACACCAGTAACCTTGGTATCTCGAGATACCAAGGTTACTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007625.1-918s1c1
Sequence:CCGGCGTGATCGTTATGAGCAAGTACTCGAGTACTTGCTCATAACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-241s1c1
Sequence:CCGGCCCAAATATAACACGTGGGAACTCGAGTTCCCACGTGTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-573s1c1
Sequence:CCGGCGGCAAGTATTATTATCAGCTCTCGAGAGCTGATAATAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-1524s1c1
Sequence:CCGGCCTGGATGAACCCATAGACTTCTCGAGAAGTCTATGGGTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-651s21c1
Sequence:CCGGCAGGGAAGAGCGGCAAGTATTCTCGAGAATACTTGCCGCTCTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1795s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-997s21c1
Sequence:CCGGTGGGCGCATCGTGATCGTTATCTCGAGATAACGATCACGATGCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1843s21c1
Sequence:CCGGTACCGTCACTTTCAAGGAATACTCGAGTATTCCTTGAAAGTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007625.2-2425s21c1
Sequence:CCGGACCAGTAACCTTGGTATATATCTCGAGATATATACCAAGGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007625
VALIDATED
CBX4 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007625.1-2336s1c1
Sequence:CCGGCGACACCAGTAACCTTGGTATCTCGAGATACCAAGGTTACTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007625.1-918s1c1
Sequence:CCGGCGTGATCGTTATGAGCAAGTACTCGAGTACTTGCTCATAACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-241s1c1
Sequence:CCGGCCCAAATATAACACGTGGGAACTCGAGTTCCCACGTGTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-573s1c1
Sequence:CCGGCGGCAAGTATTATTATCAGCTCTCGAGAGCTGATAATAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-1524s1c1
Sequence:CCGGCCTGGATGAACCCATAGACTTCTCGAGAAGTCTATGGGTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-651s21c1
Sequence:CCGGCAGGGAAGAGCGGCAAGTATTCTCGAGAATACTTGCCGCTCTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1795s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-997s21c1
Sequence:CCGGTGGGCGCATCGTGATCGTTATCTCGAGATAACGATCACGATGCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1843s21c1
Sequence:CCGGTACCGTCACTTTCAAGGAATACTCGAGTATTCCTTGAAAGTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007625.2-2425s21c1
Sequence:CCGGACCAGTAACCTTGGTATATATCTCGAGATATATACCAAGGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007625
VALIDATED
CBX4 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007625.1-2336s1c1
Sequence:CCGGCGACACCAGTAACCTTGGTATCTCGAGATACCAAGGTTACTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007625.1-918s1c1
Sequence:CCGGCGTGATCGTTATGAGCAAGTACTCGAGTACTTGCTCATAACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-241s1c1
Sequence:CCGGCCCAAATATAACACGTGGGAACTCGAGTTCCCACGTGTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-573s1c1
Sequence:CCGGCGGCAAGTATTATTATCAGCTCTCGAGAGCTGATAATAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007625.1-1524s1c1
Sequence:CCGGCCTGGATGAACCCATAGACTTCTCGAGAAGTCTATGGGTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-651s21c1
Sequence:CCGGCAGGGAAGAGCGGCAAGTATTCTCGAGAATACTTGCCGCTCTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1795s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-997s21c1
Sequence:CCGGTGGGCGCATCGTGATCGTTATCTCGAGATAACGATCACGATGCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007625.2-1843s21c1
Sequence:CCGGTACCGTCACTTTCAAGGAATACTCGAGTATTCCTTGAAAGTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007625.2-2425s21c1
Sequence:CCGGACCAGTAACCTTGGTATATATCTCGAGATATATACCAAGGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003655
VALIDATED
CBX4 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-414s1c1
Sequence:CCGGTGCCTACCTTTGCCCGTCGTTCTCGAGAACGACGGGCAAAGGTAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-230s1c1
Sequence:CCGGCGCAAGGGCAGAGTGGAGTATCTCGAGATACTCCACTCTGCCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-820s1c1
Sequence:CCGGTCCAGGCAAAGGCTCCGAGAACTCGAGTTCTCGGAGCCTTTGCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-925s1c1
Sequence:CCGGCAAGAACAAGAACGGACGCATCTCGAGATGCGTCCGTTCTTGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-960s1c1
Sequence:CCGGGCAAATACATGGAGAACGGCACTCGAGTGCCGTTCTCCATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003655.2-237s21c1
Sequence:CCGGGAGTGGAGTATCTGGTGAAATCTCGAGATTTCACCAGATACTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-949s21c1
Sequence:CCGGCGTGATCGTGATGAGCAAATACTCGAGTATTTGCTCATCACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003655.2-2130s21c1
Sequence:CCGGGCCTCAGAGTTCTAGTATTATCTCGAGATAATACTAGAACTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-1765s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-260s21c1
Sequence:CCGGAGAGGCTGGTCGCCCAAATATCTCGAGATATTTGGGCGACCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003655
VALIDATED
CBX4 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-414s1c1
Sequence:CCGGTGCCTACCTTTGCCCGTCGTTCTCGAGAACGACGGGCAAAGGTAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-230s1c1
Sequence:CCGGCGCAAGGGCAGAGTGGAGTATCTCGAGATACTCCACTCTGCCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-820s1c1
Sequence:CCGGTCCAGGCAAAGGCTCCGAGAACTCGAGTTCTCGGAGCCTTTGCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-925s1c1
Sequence:CCGGCAAGAACAAGAACGGACGCATCTCGAGATGCGTCCGTTCTTGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-960s1c1
Sequence:CCGGGCAAATACATGGAGAACGGCACTCGAGTGCCGTTCTCCATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003655.2-237s21c1
Sequence:CCGGGAGTGGAGTATCTGGTGAAATCTCGAGATTTCACCAGATACTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-949s21c1
Sequence:CCGGCGTGATCGTGATGAGCAAATACTCGAGTATTTGCTCATCACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003655.2-2130s21c1
Sequence:CCGGGCCTCAGAGTTCTAGTATTATCTCGAGATAATACTAGAACTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-1765s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-260s21c1
Sequence:CCGGAGAGGCTGGTCGCCCAAATATCTCGAGATATTTGGGCGACCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003655
VALIDATED
CBX4 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-414s1c1
Sequence:CCGGTGCCTACCTTTGCCCGTCGTTCTCGAGAACGACGGGCAAAGGTAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-230s1c1
Sequence:CCGGCGCAAGGGCAGAGTGGAGTATCTCGAGATACTCCACTCTGCCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-820s1c1
Sequence:CCGGTCCAGGCAAAGGCTCCGAGAACTCGAGTTCTCGGAGCCTTTGCCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-925s1c1
Sequence:CCGGCAAGAACAAGAACGGACGCATCTCGAGATGCGTCCGTTCTTGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003655.x-960s1c1
Sequence:CCGGGCAAATACATGGAGAACGGCACTCGAGTGCCGTTCTCCATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003655.2-237s21c1
Sequence:CCGGGAGTGGAGTATCTGGTGAAATCTCGAGATTTCACCAGATACTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-949s21c1
Sequence:CCGGCGTGATCGTGATGAGCAAATACTCGAGTATTTGCTCATCACGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003655.2-2130s21c1
Sequence:CCGGGCCTCAGAGTTCTAGTATTATCTCGAGATAATACTAGAACTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-1765s21c1
Sequence:CCGGGCCCTTCTTTGGGAATATAATCTCGAGATTATATTCCCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003655.2-260s21c1
Sequence:CCGGAGAGGCTGGTCGCCCAAATATCTCGAGATATTTGGGCGACCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks