EMAIL THIS PAGE TO A FRIEND

CBX5

chromobox homolog 5

141 Gene Product Result for
Synonyms: HP1 HP1A
UniProtKB ID: P45973, B2R8T9
Gene ID:
Human(23468) Summary: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(12419) chromobox 5
Rat(300266) chromobox homolog 5
sheep(100307036) chromobox homolog 5
domestic guinea pig(100727253) chromobox homolog 5
naked mole-rat(101710464) chromobox homolog 5
Zebrafish(563396) chromobox homolog 5 (HP1 alpha homolog, Drosophila)
dog(477593) chromobox homolog 5
cow(538885) chromobox homolog 5
domestic cat(101091461) chromobox homolog 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407213 Anti-CBX5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA016699 Anti-CBX5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV32481 Anti-CBX5 antibody produced in rabbit IgG fraction of antiserum rabbit, bovine, mouse, rat, horse, canine, human, sheep
western blot pricing
SAB4500987 Anti-CBX5 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB2500209 Anti-CBX5/HP1-α antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, Chinese hamster, canine, human
ELISA, immunohistochemistry, western blot pricing
SAB4500986 Anti-HP1 α antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
H2164 Anti-HP1α antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4301335 Anti-phospho-HP1α (pSer92) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
WH0023468M1 Monoclonal Anti-CBX5 antibody produced in mouse clone 1E11-3A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0150 Rabbit anti-CBX5 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, bovine, rhesus monkey, chimpanzee, sheep, horse, pig, dog, gorilla, rabbit, primate
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABE1010 Anti-Chromobox protein homolog 5 Antibody 100 µg, This Anti-Chromobox protein homolog 5 Antibody is validated for use in Western Blotting and Immunocytochemistry for the detection of Chromobox protein homolog 5. pricing
MAB3866 Anti-Heterochromatin Antibody 100 µL, Detect Heterochromatin with Anti-Heterochromatin Antibody (Mouse Monoclonal Antibody), that has been shown to work in ELISA, FC, ICC & IHC. pricing
MAB3584 Anti-Heterochromatin Protein-1 α Antibody, clone 2HP-1H5 100 µL, Use Anti-Heterochromatin Protein-1 α Antibody, clone 2HP-1H5 (mouse monoclonal antibody) validated in ELISA, ICC, IHC to detect Heterochromatin Protein-1 α also known as HP1a, Antigen p25, Chromobox Protein Homolog 5. pricing
MAB3446 Anti-Heterochromatin Protein-1 α Antibody, clone 2HP-2G9 100 µL, Anti-Heterochromatin Protein-1 α Antibody, clone 2HP-2G9 is a Mouse Monoclonal Antibody for detection of Heterochromatin Protein-1 α also known as HP1a, Antigen p25, Chromobox Protein Homolog 5 & has been validated in ELISA, IP & WB. pricing
MABE666 Anti-Heterochromatin Protein-1 Antibody, clone 4C12.1 100 μg, Anti-Heterochromatin Protein-1 , clone 4C12.1, Cat. No. MABE666, is a highly specific mouse monoclonal antibody that targets Heterochromatin Protein-1 alpha and has been tested in Immunohistochemistry (Paraffin) and Western Blotting. pricing
MABE590 Anti-HP1 alpha, clone EPR5776, Rabbit Monoclonal Antibody 100 µL, This Anti-HP1 alpha antibody is validated for use in WB, FC for the detection of HP1 alpha. pricing
05-689 Anti-HP1α Antibody, clone15.19s2 200 µg, Anti-HP1α Antibody, clone15.19s2 is a Mouse Monoclonal Antibody for detection of HP1α also known as HP1Hs alpha, Heterochromatin protein 1 homolog alpha & has been validated in ChIP, ICC, IHC, IP & WB. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127321 Rosetta Predictions human pricing
NM_001127322 Rosetta Predictions human pricing
NM_012117 Rosetta Predictions human pricing
NM_001106797 Rosetta Predictions rat pricing
NM_001076789 Rosetta Predictions mouse pricing
NM_001110216 Rosetta Predictions mouse pricing
NM_007626 Rosetta Predictions mouse pricing
XM_001000807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329097 predicted 637
2 SASI_Hs02_00329098 predicted 515
3 SASI_Hs02_00329099 predicted 850
4 SASI_Hs02_00329100 predicted 973
5 SASI_Hs02_00329101 predicted 189
6 SASI_Hs02_00329102 predicted 828
7 SASI_Hs02_00329103 predicted 902
8 SASI_Hs02_00329104 predicted 898
9 SASI_Hs02_00329105 predicted 886
10 SASI_Hs02_00329106 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329107 predicted 844
2 SASI_Hs02_00329108 predicted 716
3 SASI_Hs02_00329109 predicted 1050
4 SASI_Hs02_00329110 predicted 1177
5 SASI_Hs02_00329111 predicted 389
6 SASI_Hs02_00329112 predicted 1025
7 SASI_Hs02_00329113 predicted 1102
8 SASI_Hs02_00329114 predicted 1094
9 SASI_Hs02_00329115 predicted 1086
10 SASI_Hs02_00329116 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343652 predicted 687
2 SASI_Hs01_00202515 predicted 564
3 SASI_Hs02_00343653 predicted 901
4 SASI_Hs02_00343654 predicted 1021
5 SASI_Hs01_00202507 predicted 235
6 SASI_Hs02_00343655 predicted 875
7 SASI_Hs02_00343656 predicted 942
8 SASI_Hs02_00343657 predicted 943
9 SASI_Hs02_00343658 predicted 935
10 SASI_Hs02_00343659 predicted 847
11 SASI_Hs01_00202506 predicted 219
12 SASI_Hs01_00202508 predicted 219
13 SASI_Hs01_00202509 predicted 225
14 SASI_Hs01_00202510 predicted 219
15 SASI_Hs01_00202511 predicted 228
16 SASI_Hs01_00202512 predicted 206
17 SASI_Hs01_00202513 predicted 216
18 SASI_Hs01_00202514 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222498 predicted 899
2 SASI_Rn02_00222499 predicted 847
3 SASI_Rn02_00222500 predicted 211
4 SASI_Rn02_00222501 predicted 910
5 SASI_Rn02_00222502 predicted 751
6 SASI_Rn02_00222503 predicted 774
7 SASI_Rn02_00222504 predicted 806
8 SASI_Rn02_00222505 predicted 255
9 SASI_Rn02_00222506 predicted 933
10 SASI_Rn02_00222507 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292349 predicted 732
2 SASI_Mm02_00292350 predicted 778
3 SASI_Mm02_00292351 predicted 841
4 SASI_Mm02_00292352 predicted 892
5 SASI_Mm02_00292353 predicted 713
6 SASI_Mm02_00292354 predicted 1069
7 SASI_Mm02_00292355 predicted 1128
8 SASI_Mm02_00292356 predicted 858
9 SASI_Mm02_00292357 predicted 1118
10 SASI_Mm02_00292358 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304986 predicted 881
2 SASI_Mm02_00304987 predicted 943
3 SASI_Mm02_00304988 predicted 998
4 SASI_Mm02_00304989 predicted 943
5 SASI_Mm02_00304990 predicted 1165
6 SASI_Mm02_00304991 predicted 1226
7 SASI_Mm02_00304992 predicted 1221
8 SASI_Mm02_00304993 predicted 954
9 SASI_Mm02_00304994 predicted 1261
10 SASI_Mm02_00304995 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312093 predicted 730
2 SASI_Mm01_00024852 predicted 779
3 SASI_Mm01_00024853 predicted 839
4 SASI_Mm01_00024857 predicted 889
5 SASI_Mm02_00312094 predicted 711
6 SASI_Mm02_00312095 predicted 1064
7 SASI_Mm02_00312096 predicted 1122
8 SASI_Mm01_00024859 predicted 851
9 SASI_Mm02_00312097 predicted 1113
10 SASI_Mm02_00312098 predicted 1165
11 SASI_Mm01_00024854 predicted 982
12 SASI_Mm01_00024855 predicted 655
13 SASI_Mm01_00024856 predicted 855
14 SASI_Mm01_00024858 predicted 777
15 SASI_Mm01_00024860 predicted 863
16 SASI_Mm01_00024861 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278393 predicted 686
2 SASI_Mm01_00278394 predicted 709
3 SASI_Mm01_00278395 predicted 712
4 SASI_Mm01_00278396 predicted 720
5 SASI_Mm01_00278397 predicted 784
6 SASI_Mm01_00278398 predicted 306
7 SASI_Mm01_00278399 predicted 718
8 SASI_Mm01_00278400 predicted 335
9 SASI_Mm01_00278401 predicted 511
10 SASI_Mm01_00278402 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012117
VALIDATED
CBX5 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-556s21c1
Sequence:GTACCGGAGATTCCTGTGGTGATTTAATCTCGAGATTAAATCACCACAGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-427s21c1
Sequence:GTACCGGTAACAAGAGGAAATCCAATTTCTCGAGAAATTGGATTTCCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-484s21c1
Sequence:CCGGGAGAGAGCAGAGCAATGATATCTCGAGATATCATTGCTCTGCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-647s21c1
Sequence:CCGGCCACAAATTGTGATAGCATTTCTCGAGAAATGCTATCACAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-344s21c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-458s21c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-825s21c1
Sequence:CCGGTATCCTAAACACATCCATAAACTCGAGTTTATGGATGTGTTTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-312s1c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-426s1c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-614s1c1
Sequence:CCGGTCCACAAATTGTGATAGCATTCTCGAGAATGCTATCACAATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-532s1c1
Sequence:CCGGGTGGTGATTTAATGTTCCTAACTCGAGTTAGGAACATTAAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012117
VALIDATED
CBX5 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-556s21c1
Sequence:GTACCGGAGATTCCTGTGGTGATTTAATCTCGAGATTAAATCACCACAGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-427s21c1
Sequence:GTACCGGTAACAAGAGGAAATCCAATTTCTCGAGAAATTGGATTTCCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-484s21c1
Sequence:CCGGGAGAGAGCAGAGCAATGATATCTCGAGATATCATTGCTCTGCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-647s21c1
Sequence:CCGGCCACAAATTGTGATAGCATTTCTCGAGAAATGCTATCACAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-344s21c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-458s21c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-825s21c1
Sequence:CCGGTATCCTAAACACATCCATAAACTCGAGTTTATGGATGTGTTTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-312s1c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-426s1c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-614s1c1
Sequence:CCGGTCCACAAATTGTGATAGCATTCTCGAGAATGCTATCACAATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-532s1c1
Sequence:CCGGGTGGTGATTTAATGTTCCTAACTCGAGTTAGGAACATTAAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012117
VALIDATED
CBX5 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-556s21c1
Sequence:GTACCGGAGATTCCTGTGGTGATTTAATCTCGAGATTAAATCACCACAGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-427s21c1
Sequence:GTACCGGTAACAAGAGGAAATCCAATTTCTCGAGAAATTGGATTTCCTCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-484s21c1
Sequence:CCGGGAGAGAGCAGAGCAATGATATCTCGAGATATCATTGCTCTGCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-647s21c1
Sequence:CCGGCCACAAATTGTGATAGCATTTCTCGAGAAATGCTATCACAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-344s21c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-458s21c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012117.2-825s21c1
Sequence:CCGGTATCCTAAACACATCCATAAACTCGAGTTTATGGATGTGTTTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-312s1c1
Sequence:CCGGCCTGAGCTAATTTCTGAATTTCTCGAGAAATTCAGAAATTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-426s1c1
Sequence:CCGGGCCGATGACATCAAATCTAAACTCGAGTTTAGATTTGATGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-614s1c1
Sequence:CCGGTCCACAAATTGTGATAGCATTCTCGAGAATGCTATCACAATTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012117.1-532s1c1
Sequence:CCGGGTGGTGATTTAATGTTCCTAACTCGAGTTAGGAACATTAAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007626
VALIDATED
CBX5 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-309s21c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-530s21c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007626.3-1514s21c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-421s21c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-612s21c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-1446s1c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007626.2-244s1c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-465s1c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-547s1c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-356s1c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007626
VALIDATED
CBX5 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-309s21c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-530s21c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007626.3-1514s21c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-421s21c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-612s21c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-1446s1c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007626.2-244s1c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-465s1c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-547s1c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-356s1c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007626
VALIDATED
CBX5 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-309s21c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-530s21c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007626.3-1514s21c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-421s21c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007626.3-612s21c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-1446s1c1
Sequence:CCGGCCCTCATATTTAGACTGTATTCTCGAGAATACAGTCTAAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007626.2-244s1c1
Sequence:CCGGCCTGAACTAATTTCTGAGTTTCTCGAGAAACTCAGAAATTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-465s1c1
Sequence:CCGGCGGTGACTTAATGTTCTTAATCTCGAGATTAAGAACATTAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-547s1c1
Sequence:CCGGCCACAGATTGTGATAGCATTTCTCGAGAAATGCTATCACAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007626.2-356s1c1
Sequence:CCGGGCGCTGATGATATTAAATCTACTCGAGTAGATTTAATATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks