EMAIL THIS PAGE TO A FRIEND

CBX6

chromobox homolog 6

89 Gene Product Result for
UniProtKB ID: O95503, A8KAH0, Q96EM5
Gene ID:
Mouse(494448) chromobox 6
Rat(315136) chromobox homolog 6
dog(481249) chromobox homolog 6
cow(513830) chromobox homolog 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39073 Anti-CBX6 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, rat, rabbit, horse, bovine, guinea pig, human, zebrafish, mouse
immunohistochemistry, western blot pricing
AV39074 Anti-CBX6 (AB2) antibody produced in rabbit IgG fraction of antiserum , rat, human, canine, guinea pig, horse, bovine, mouse
western blot pricing
HPA048653 Anti-CBX6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500985 Anti-CBX6, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014292 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047411 MISSION® esiRNA esiRNA human CBX6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014292 Rosetta Predictions human pricing
NM_001012119 Rosetta Predictions rat pricing
XM_576309 Rosetta Predictions rat pricing
NM_028763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147482 predicted 331
2 SASI_Hs01_00147484 predicted 1581
3 SASI_Hs01_00147485 predicted 1627
4 SASI_Hs01_00147486 predicted 220
5 SASI_Hs02_00345380 predicted 1588
6 SASI_Hs01_00147483 predicted 1734
7 SASI_Hs01_00147487 predicted 1153
8 SASI_Hs01_00147488 predicted 133
9 SASI_Hs01_00147489 predicted 82
10 SASI_Hs01_00147490 predicted 501
11 SASI_Hs01_00147491 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089639 predicted 1078
2 SASI_Rn02_00200282 predicted 614
3 SASI_Rn02_00200283 predicted 1228
4 SASI_Rn01_00089641 predicted 409
5 SASI_Rn01_00089642 predicted 632
6 SASI_Rn01_00089644 predicted 882
7 SASI_Rn01_00089645 predicted 1511
8 SASI_Rn01_00089646 predicted 246
9 SASI_Rn01_00089647 predicted 760
10 SASI_Rn02_00200284 predicted 1293
11 SASI_Rn01_00089638 predicted 1063
12 SASI_Rn01_00089640 predicted 479
13 SASI_Rn01_00089643 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00157704 predicted 1165
2 SASI_Rn01_00157705 predicted 1188
3 SASI_Rn01_00157706 predicted 585
4 SASI_Rn01_00157707 predicted 1153
5 SASI_Rn01_00157708 predicted 744
6 SASI_Rn01_00157709 predicted 979
7 SASI_Rn01_00157710 predicted 993
8 SASI_Rn01_00157711 predicted 1167
9 SASI_Rn01_00157712 predicted 863
10 SASI_Rn01_00157713 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334355 predicted 426
2 SASI_Mm01_00108331 predicted 386
3 SASI_Mm01_00108333 predicted 387
4 SASI_Mm02_00334356 predicted 276
5 SASI_Mm02_00334357 predicted 282
6 SASI_Mm02_00334358 predicted 431
7 SASI_Mm01_00108334 predicted 374
8 SASI_Mm02_00334359 predicted 266
9 SASI_Mm01_00108339 predicted 311
10 SASI_Mm02_00334360 predicted 386
11 SASI_Mm01_00108330 predicted 312
12 SASI_Mm01_00108332 predicted 426
13 SASI_Mm01_00108335 predicted 397
14 SASI_Mm01_00108336 predicted 397
15 SASI_Mm01_00108337 predicted 377
16 SASI_Mm01_00108338 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028763
CBX6 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-106s1c1
Sequence:CCGGGAGTACCTGGTGAAATGGAAACTCGAGTTTCCATTTCACCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-501s1c1
Sequence:CCGGCATCATCAACCGTAAGGTGAACTCGAGTTCACCTTACGGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1262s1c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-263s1c1
Sequence:CCGGCATTCTGGATTCGAGGCTCATCTCGAGATGAGCCTCGAATCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1047s1c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-798s1c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028763.3-3992s1c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-555s1c1
Sequence:CCGGGAACCTGAAGGTGATTGACAACTCGAGTTGTCAATCACCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1047s21c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-798s21c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1262s21c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028763.3-3992s21c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028763
CBX6 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-106s1c1
Sequence:CCGGGAGTACCTGGTGAAATGGAAACTCGAGTTTCCATTTCACCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-501s1c1
Sequence:CCGGCATCATCAACCGTAAGGTGAACTCGAGTTCACCTTACGGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1262s1c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-263s1c1
Sequence:CCGGCATTCTGGATTCGAGGCTCATCTCGAGATGAGCCTCGAATCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1047s1c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-798s1c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028763.3-3992s1c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-555s1c1
Sequence:CCGGGAACCTGAAGGTGATTGACAACTCGAGTTGTCAATCACCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1047s21c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-798s21c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1262s21c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028763.3-3992s21c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028763
CBX6 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-106s1c1
Sequence:CCGGGAGTACCTGGTGAAATGGAAACTCGAGTTTCCATTTCACCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-501s1c1
Sequence:CCGGCATCATCAACCGTAAGGTGAACTCGAGTTCACCTTACGGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1262s1c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-263s1c1
Sequence:CCGGCATTCTGGATTCGAGGCTCATCTCGAGATGAGCCTCGAATCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-1047s1c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028763.3-798s1c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028763.3-3992s1c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028763.2-555s1c1
Sequence:CCGGGAACCTGAAGGTGATTGACAACTCGAGTTGTCAATCACCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1047s21c1
Sequence:CCGGCGAGAGTCAGAGGTGCTCGATCTCGAGATCGAGCACCTCTGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-798s21c1
Sequence:CCGGCACATGAAGTTTGGCACATTTCTCGAGAAATGTGCCAAACTTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028763.3-1262s21c1
Sequence:CCGGGACCGTGACCATCAAGGAATTCTCGAGAATTCCTTGATGGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028763.3-3992s21c1
Sequence:CCGGGCAGTCCAATTTGCTTTATTTCTCGAGAAATAAAGCAAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014292
VALIDATED
CBX6 MISSION shRNA Bacterial Glycerol Stock
chromobox homolog 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-293s1c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014292.2-683s1c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-641s1c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-1156s1c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-97s1c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-723s21c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-681s21c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-333s21c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-137s21c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-1196s21c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014292
VALIDATED
CBX6 MISSION shRNA shRNA Plasmid DNA
chromobox homolog 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-293s1c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014292.2-683s1c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-641s1c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-1156s1c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-97s1c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-723s21c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-681s21c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-333s21c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-137s21c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-1196s21c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014292
VALIDATED
CBX6 MISSION shRNA Lentiviral Transduction Particles
chromobox homolog 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-293s1c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014292.2-683s1c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-641s1c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-1156s1c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014292.2-97s1c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-723s21c1
Sequence:CCGGGCGTACACAGATCCGCCACATCTCGAGATGTGGCGGATCTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-681s21c1
Sequence:CCGGCCGCGTTATAGGCAAGAGCAACTCGAGTTGCTCTTGCCTATAACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-333s21c1
Sequence:CCGGCCGCATCAGTGATGTGCATTTCTCGAGAAATGCACATCACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-137s21c1
Sequence:CCGGGCATCGAGTACCTGGTGAAATCTCGAGATTTCACCAGGTACTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014292.3-1196s21c1
Sequence:CCGGTGACGGTCACAATCAAGGAATCTCGAGATTCCTTGATTGTGACCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks